diff --git a/.gitignore b/.gitignore index fcc3e19..0989ced 100644 --- a/.gitignore +++ b/.gitignore @@ -1,7 +1,13 @@ +# generic ignores +*.Rhistory +*.RData +*.Rproj.user +.ipynb_checkpoints .vscode exercises/* templates/*.html templates/*_files + # pixi environments .pixi/* !.pixi/config.toml diff --git a/LICENSE b/LICENSE new file mode 100644 index 0000000..968dd63 --- /dev/null +++ b/LICENSE @@ -0,0 +1,21 @@ +MIT License + +Copyright (c) 2026 Max Planck Unit for the Science of Pathogens + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. diff --git a/README.md b/README.md index ab86315..f114a80 100644 --- a/README.md +++ b/README.md @@ -6,19 +6,45 @@ This Github repository contains all course materials. Issues can be reported [he For comments, criticism, and general feedback please contact the [authors](#authors) at bioinformatics@mpusp.mpg.de -## Course materials and structure +## Course materials + +### Sources and license + +The course materials are a blend of own works and code examples from Justin Bois' [Introduction to Programming in the Biological Sciences Bootcamp](https://justinbois.github.io/bootcamp/2024/). The code examples from the Bootcamp course are released with the [MIT License](https://opensource.org/license/mit). + +All other code examples and documentation added by the [authors](#authors) is also released under the [MIT License](https://opensource.org/license/mit), except where explicitly noted. + +All example datasets are taken from published sources which are referenced in [Data sources](#data-sources). +These datasets are **not covered by the MIT License**, but are licensed under their respective terms. ### Dependencies In order to work with the course materials, you need to have [Python](https://www.python.org/downloads/), [R](https://cran.r-project.org/mirrors.html), and optionally [Quarto](https://quarto.org/docs/get-started/) (a notebook framework) installed. +With [`pixi`](https://pixi.prefix.dev) as package manager (recommended), you can create an environment with the required dependencies by running: + +```bash +pixi init +pixi add python pandas matplotlib jupyter r-tidyverse r-irkernel +``` + +Or simply use the provided `pixi.toml` file to activate the environment: + +```bash +pixi shell +``` + With conda/mamba, you can create an environment with all dependencies by running: ```bash -mamba create -p /python-course python pandas matplotlib jupyter quarto r-recommended r-tidyverse r-reticulate +mamba create -p /python-course python pandas matplotlib jupyter r-tidyverse r-irkernel mamba activate python-course ``` +When using Jupyter Notebooks (in VSCode), make sure to select the correct kernel (Python or R) for each notebook. + +The R kernel for Jupyter is installed with the `r-irkernel` package, a detailed setup for VSCode can be found [here](https://davidzhao1015.github.io/blog/2024/R-kernel-jupyter/). + When running a Quarto notebook, make sure that the R package `reticulate` is installed and configured to use the correct Python environment. You can specify the path to the Python binary by running the following command in the terminal: ```bash @@ -35,21 +61,23 @@ export RETICULATE_PYTHON="/path/to/your/env/bin/python" - `data/`: Contains datasets used in the course - `lessons/`: Contains the lesson notebooks, e.g. in Jupyter format (`.ipynb`) +- `solutions/`: Contains solutions to the exercises provided in the lessons - `templates`: Contains templates for creating new lessons or exercises - `README.md`: Instructions and information about the course - `.gitignore`: Specifies files and directories to be ignored by Git -## Data origins / citations: -- gfmt_sleep*: Beattie, L., Walsh, D., McLaren, J., Biello, S.M. and White, D., 2016. Perceptual impairment in face identification with poor sleep. Royal Society Open Science, 3(10). -- iris.data: Anderson, E., 1935. The irises of the Gaspe Peninsula. Bulletin of American Iris Society, 59, pp.2-5. -- ls_orchids.*: Cox, A.V., Pridgeon, A.M., Albert, V.A. and Chase, M.W., 1997. Phylogenetics of the slipper orchids (Cypripedioideae, Orchidaceae): nuclear rDNA ITS sequences. Plant Systematics and Evolution, 208(3), pp.197-223. -- NC_005816.gb: Zhou, D., Tong, Z., Song, Y., Han, Y., Pei, D., Pang, X., Zhai, J., Li, M., Cui, B., Qi, Z. and Jin, L., 2004. Genetics of metabolic variations between Yersinia pestis biovars and the proposal of a new biovar, microtus. Journal of bacteriology, 186(15), pp.5147-5152. -- reeves_gradient_width_various_methods.cvs: Reeves, G.T., Trisnadi, N., Truong, T.V., Nahmad, M., Katz, S. and Stathopoulos, A., 2012. Dorsal-ventral gene expression in the Drosophila embryo reflects the dynamics and precision of the dorsal nuclear gradient. Developmental cell, 22(3), pp.544-557. -- towels.txt: Douglas Adams, The Hitch Hiker's Guide to the Galaxy, ISBN: 0345391802 +## Data sources + +- `gfmt_sleep\*`: Beattie, L., Walsh, D., McLaren, J., Biello, S.M. and White, D., 2016. Perceptual impairment in face identification with poor sleep. Royal Society Open Science, 3(10). Released to [Public domain, CC0](https://datadryad.org/dataset/doi:10.5061/dryad.r620r). +- `iris.data`: Anderson, E., 1935. The irises of the Gaspe Peninsula. Bulletin of American Iris Society, 59, pp.2-5. [CC-BY-4.0 License](https://doi.org/10.1111/j.1469-1809.1936.tb02137.x). +- `ls_orchids.\*`: Cox, A.V., Pridgeon, A.M., Albert, V.A. and Chase, M.W., 1997. Phylogenetics of the slipper orchids (Cypripedioideae, Orchidaceae): nuclear rDNA ITS sequences. Plant Systematics and Evolution, 208(3), pp.197-223. [Freely available on NCBI](https://www.ncbi.nlm.nih.gov/nuccore/?term=Phylogenetics%20of%20the%20slipper%20orchids). +- `NC_005816.gb`: Zhou, D., Tong, Z., Song, Y., Han, Y., Pei, D., Pang, X., Zhai, J., Li, M., Cui, B., Qi, Z. and Jin, L., 2004. Genetics of metabolic variations between Yersinia pestis biovars and the proposal of a new biovar, microtus. Journal of bacteriology, 186(15), pp.5147-5152. [Freely available on NCBI](https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_000007885.1/). +- `Jahn_eLife_2021.csv`: Jahn, M., Crang, N., Janasch, M., Hober, A., Forsström, B., Kimler, K., Mattausch, A., Chen, Q., Asplund-Samuelsson, J., & Hudson, E. P. (2021). Protein allocation and utilization in the versatile chemolithoautotroph Cupriavidus necator. eLife, 10(e69019), 1–26. [Freely available on Github, GPL v3](https://github.com/m-jahn/R-notebook-ralstonia-proteome). -## Adding and changing contents +## Contributions -To be added. +**Contributions to the course materials are very welcome!** +If you have suggestions for improvements, or want to report issues, please feel free to [open an issue](https://github.com/MPUSP/coding-for-biologists/issues) or submit a pull request on GitHub. ## Authors diff --git a/data/Jahn_eLife_2021.csv b/data/Jahn_eLife_2021.csv new file mode 100644 index 0000000..263a995 --- /dev/null +++ b/data/Jahn_eLife_2021.csv @@ -0,0 +1,21 @@ +uniprot,substrate,growthrate,R1,R2,R3,R4 +Q0K1H0,formate,0.05,900578172,441270170,3122542832,680060600 +Q0K1H0,formate,0.1,614552208,2398450248,366775320,1015804992 +Q0K1H0,formate,0.15,705491384,367461526,803938584,782118008 +Q0K1H0,formate,0.2,438389228,580611700,938426916,464743138 +Q0K1H0,formate,0.25,522893276,1364078846,1373663968,942002356 +Q0K1H0,fructose,0.05,305158214,332735058,1400748272,877117100 +Q0K1H0,fructose,0.1,78090540,NA,396061392,778370782 +Q0K1H0,fructose,0.15,15727490,464742468,398025584,260101530 +Q0K1H0,fructose,0.2,79098500,590114016,133964096,296108304 +Q0K1H0,fructose,0.25,32359600,257136500,201190480,89447700 +Q0K1H0,ammonium,0.05,72514300,378991192,1095938008,641173112 +Q0K1H0,ammonium,0.1,8652209052,1020382916,682807584,388322042 +Q0K1H0,ammonium,0.15,292831192,728197400,691936776,243449700 +Q0K1H0,ammonium,0.2,181858100,260700392,5612858216,6030139888 +Q0K1H0,ammonium,0.25,7295757960,284956160,658380400,259553392 +Q0K1H0,succinate,0.05,607908460,418218000,463238600,692957484 +Q0K1H0,succinate,0.1,460987046,385657000,469888616,310468790 +Q0K1H0,succinate,0.15,450655732,408609784,1087130084,333188100 +Q0K1H0,succinate,0.2,299384900,656712030,591076116,691310308 +Q0K1H0,succinate,0.25,427697608,289053748,562829796,211568150 diff --git a/data/reeves_gradient_width_various_methods.csv b/data/reeves_gradient_width_various_methods.csv deleted file mode 100644 index dbcf613..0000000 --- a/data/reeves_gradient_width_various_methods.csv +++ /dev/null @@ -1,164 +0,0 @@ -# Raw data from Reeves, et al., Dev. Cell, 22, 544, 2012. -# -# These data were used to create figure 1F. -# -# The first row of column headings contains the genotypes. -# The second row contains the staining/visualization method. -# The data give the computed gradient width as parametrized by -# sigma (see the original paper). -# -# Kindly provided by Greg Reeves (NC State) and Nathanie Trisnadi and Angela Stathopoulos (Caltech) -wt,wt,dl1/+; dl-venus/+,dl1/+; dl-venus/+,dl1/+; dl-venus/+,dl1/+; dl-gfp/+,dl1/+; dl-gfp/+,dl1/+; dl-gfp/+ -wholemounts,cross-sections,anti-Dorsal,anti-Venus,Venus (live),anti-Dorsal,anti-GFP,GFP (live) -0.1288,0.1327,0.1482,0.1632,0.1666,0.2248,0.2389,0.2412 -0.1554,0.1457,0.1503,0.1671,0.1753,0.1891,0.2035,0.1942 -0.1306,0.1447,0.1577,0.1704,0.1705,0.1705,0.1943,0.2186 -0.1413,0.1282,0.1711,0.1779,,0.1735,0.2,0.2104 -0.1557,0.1487,0.1342,0.1483,,0.2135,0.256,0.2463 -0.1689,0.1203,0.1773,0.1831,,0.2129,0.2309,0.202 -0.1417,0.1315,0.1705,0.1783,,0.1782,0.1949, -0.1315,0.1463,0.1596,0.1667,,0.2011,0.2216, -0.1664,0.1458,0.1601,0.178,,0.1931,0.23, -0.156,0.1402,0.1553,0.1653,,0.2146,0.2682, -0.1479,0.133,0.1675,0.1708,,0.2398,0.2633, -0.1475,0.1375,0.1692,0.178,,0.2193,0.2495, -0.1347,0.1576,0.1584,0.174,,0.2112,0.2353, -0.1129,0.1498,0.1546,0.1739,,0.2516,0.2642, -0.125,0.1532,0.1605,0.1812,,0.1759,0.2238, -0.1648,0.1352,0.1754,0.1902,,0.1787,0.2115, -0.1555,0.1346,0.161,0.178,,0.164,0.1934, -0.1403,0.1364,0.1491,0.1624,,0.1756,0.2041, -0.1096,0.143,0.1442,0.1553,,0.1977,0.2286, -0.1779,0.144,0.1728,0.1768,,0.1809,0.2104, -0.1244,0.1805,0.1534,0.1701,,,, -0.1708,0.1688,0.1576,0.1724,,,, -0.1691,0.1532,0.1701,0.1738,,,, -0.13,0.1681,0.1436,0.1703,,,, -,0.1442,0.1746,0.1842,,,, -,0.1362,0.1698,0.172,,,, -,0.1391,0.171,0.1807,,,, -,0.1606,0.1555,0.1796,,,, -,0.1742,0.1616,0.1759,,,, -,0.1335,,,,,, -,0.1347,,,,,, -,0.1404,,,,,, -,0.1524,,,,,, -,0.1469,,,,,, -,0.1365,,,,,, -,0.1433,,,,,, -,0.1358,,,,,, -,0.1643,,,,,, -,0.1371,,,,,, -,0.1141,,,,,, -,0.1436,,,,,, -,0.1223,,,,,, -,0.1459,,,,,, -,0.1368,,,,,, -,0.1376,,,,,, -,0.1601,,,,,, -,0.1309,,,,,, -,0.1305,,,,,, -,0.1562,,,,,, -,0.1577,,,,,, -,0.154,,,,,, -,0.1443,,,,,, -,0.1364,,,,,, -,0.1344,,,,,, -,0.1315,,,,,, -,0.1572,,,,,, -,0.1441,,,,,, -,0.1399,,,,,, -,0.1497,,,,,, -,0.1647,,,,,, -,0.1629,,,,,, -,0.1194,,,,,, -,0.1296,,,,,, -,0.1574,,,,,, -,0.1365,,,,,, -,0.1759,,,,,, -,0.1522,,,,,, -,0.1535,,,,,, -,0.1398,,,,,, -,0.1453,,,,,, -,0.1569,,,,,, -,0.1582,,,,,, -,0.174,,,,,, -,0.1781,,,,,, -,0.1488,,,,,, -,0.1663,,,,,, -,0.1699,,,,,, -,0.173,,,,,, -,0.1655,,,,,, -,0.1341,,,,,, -,0.1014,,,,,, -,0.162,,,,,, -,0.1704,,,,,, -,0.1499,,,,,, -,0.1648,,,,,, -,0.1397,,,,,, -,0.1745,,,,,, -,0.1684,,,,,, -,0.1399,,,,,, -,0.1512,,,,,, -,0.1793,,,,,, -,0.1581,,,,,, -,0.1515,,,,,, -,0.1465,,,,,, -,0.162,,,,,, -,0.1581,,,,,, -,0.1559,,,,,, -,0.147,,,,,, -,0.1445,,,,,, -,0.1673,,,,,, -,0.1703,,,,,, -,0.154,,,,,, -,0.16,,,,,, -,0.1147,,,,,, -,0.1317,,,,,, -,0.1685,,,,,, -,0.1415,,,,,, -,0.1575,,,,,, -,0.1524,,,,,, -,0.1374,,,,,, -,0.1596,,,,,, -,0.1159,,,,,, -,0.1104,,,,,, -,0.1368,,,,,, -,0.1621,,,,,, -,0.1117,,,,,, -,0.1563,,,,,, -,0.158,,,,,, -,0.146,,,,,, -,0.1174,,,,,, -,0.155,,,,,, -,0.1327,,,,,, -,0.1443,,,,,, -,0.1329,,,,,, -,0.1567,,,,,, -,0.1388,,,,,, -,0.1449,,,,,, -,0.1548,,,,,, -,0.1727,,,,,, -,0.142,,,,,, -,0.1735,,,,,, -,0.1641,,,,,, -,0.1756,,,,,, -,0.1691,,,,,, -,0.1599,,,,,, -,0.1271,,,,,, -,0.1468,,,,,, -,0.149,,,,,, -,0.1706,,,,,, -,0.1283,,,,,, -,0.1325,,,,,, -,0.1663,,,,,, -,0.1325,,,,,, -,0.1529,,,,,, -,0.1682,,,,,, -,0.1557,,,,,, -,0.1577,,,,,, -,0.1466,,,,,, -,0.1671,,,,,, -,0.1265,,,,,, -,0.1448,,,,,, -,0.174,,,,,, \ No newline at end of file diff --git a/data/towels.txt b/data/towels.txt deleted file mode 100644 index f29427f..0000000 --- a/data/towels.txt +++ /dev/null @@ -1,33 +0,0 @@ -The Hitch Hiker's Guide to the Galaxy has a few things to -say on the subject of towels. -A towel, it says, is about the most massively useful thing -an interstellar hitchhiker can have. Partly it has great -practical value - you can wrap it around you for warmth as -you bound across the cold moons of Jaglan Beta; you can lie -on it on the brilliant marble-sanded beaches of Santraginus -V, inhaling the heady sea vapours; you can sleep under it -beneath the stars which shine so redly on the desert world -of Kakrafoon; use it to sail a mini raft down the slow heavy -river Moth; wet it for use in hand-to- hand-combat; wrap it -round your head to ward off noxious fumes or to avoid the -gaze of the Ravenous Bugblatter Beast of Traal (a -mindboggingly stupid animal, it assumes that if you can't -see it, it can't see you - daft as a bush, but very -ravenous); you can wave your towel in emergencies as a -distress signal, and of course dry yourself off with it if -it still seems to be clean enough. More importantly, a -towel has immense psychological value. For some reason, if -a strag (strag: non-hitch hiker) discovers that a hitch -hiker has his towel with him, he will automatically assume -that he is also in possession of a toothbrush, face flannel, -soap, tin of biscuits, flask, compass, map, ball of string, -gnat spray, wet weather gear, space suit etc., etc. -Furthermore, the strag will then happily lend the hitch -hiker any of these or a dozen other items that the hitch -hiker might accidentally have "lost". What the strag will -think is that any man who can hitch the length and breadth -of the galaxy, rough it, slum it, struggle against terrible -odds, win through, and still knows where his towel is is -clearly a man to be reckoned with. - -Douglas Adams: "The Hitchhiker's Guide to the Galaxy" diff --git a/lessons/lesson_01.ipynb b/lessons/lesson_01.ipynb index fda478e..9b5923e 100644 --- a/lessons/lesson_01.ipynb +++ b/lessons/lesson_01.ipynb @@ -36,9 +36,10 @@ "## Course materials and structure\n", "\n", "- all course participants can be contacted via the mailing list `python_2026@mpusp.mpg.de`\n", - "- all materials are available at our Github repository: https://github.com/MPUSP/python_course/ (currently private)\n", + "- all materials are available at our Github repository: https://github.com/MPUSP/python_course/\n", "- each lesson is provided as a Jupyter notebook (`.ipynb`), or alternatively a Quarto (`.qmd`) or R markdown (`.Rmd`) notebook\n", - "- the course material is a blend of own works examples from Justin Bois from Caltech (http://bois.caltech.edu/)\n", + "- the course materials are a blend of own works and code examples from Justin Bois' [Introduction to Programming in the Biological Sciences Bootcamp](https://justinbois.github.io/bootcamp/2024/). The code examples from the Bootcamp course are released with the [MIT License](https://opensource.org/license/mit).\n", + "- all other content that was added is also released under the [MIT License](https://opensource.org/license/mit), except where explicitly noted\n", "- each lesson is supposed to be worked through in about 90 minutes\n", "- the course is **interactive (!)**: we will mix small introductory lectures with hands-on exercises\n", "- participants are expected to actively work through the notebooks, run code cells, and try to understand/solve the given tasks\n", diff --git a/lessons/lesson_07.ipynb b/lessons/lesson_07.ipynb index 5f174ba..9103379 100644 --- a/lessons/lesson_07.ipynb +++ b/lessons/lesson_07.ipynb @@ -189,7 +189,7 @@ " action=\"store_true\",\n", " help=\"run unit test\",\n", ")\n", - "args = parser.parse_args()\n", + "# args = parser.parse_args()\n", "\n", "# print(args.info)\n", "# print(args.unit_test)" @@ -272,16 +272,16 @@ "source": [ "import re\n", "\n", - "# reading file\n", - "with open(\"../data/towels.txt\", \"r\") as infile:\n", - " story = infile.read()\n", + "# # reading file\n", + "# with open(\"../data/towels.txt\", \"r\") as infile:\n", + "# story = infile.read()\n", "\n", - "# create pattern\n", - "pattern = \".*[H|h]itch *[H|h]iker.*\"\n", - "regex = re.compile(pattern)\n", + "# # create pattern\n", + "# pattern = \".*[H|h]itch *[H|h]iker.*\"\n", + "# regex = re.compile(pattern)\n", "\n", - "# search for pattern and print each line with the pattern in it\n", - "print(regex.findall(story))" + "# # search for pattern and print each line with the pattern in it\n", + "# print(regex.findall(story))" ] }, { @@ -663,7 +663,7 @@ "outputs": [], "source": [ "# showing first 10 lines of the file, missing data indicated by *\n", - "print(\"\\n\".join(open(\"data/gfmt_sleep.csv\").read().split(\"\\n\")[:10]))" + "print(\"\\n\".join(open(\"../data/gfmt_sleep.csv\").read().split(\"\\n\")[:10]))" ] }, { @@ -941,7 +941,7 @@ "metadata": {}, "outputs": [], "source": [ - "df.to_csv(\"data/gfmt_sleep_with_insomnia.csv\", index=False)" + "df.to_csv(\"../data/gfmt_sleep_with_insomnia.csv\", index=False)" ] }, { @@ -1005,12 +1005,22 @@ "metadata": {}, "source": [ "## Tidying up a dataset\n", - "- as outlined before, humanly readable data is rarely easy to handle, so called `wide format`\n", + "\n", + "- as outlined before, data often comes in the so called `wide format`, which is impractical for analysis\n", "- the following code will provide an example on how to:\n", " - read in a raw data file\n", " - re-assemble a table with one parameter per column. We will use the function `melt()` for that. This is called `long format`\n", - " - calculate general statistics\n", - "- the data comes from Reeves et al. 2012 in Developmental Cell https://doi.org/10.1016/j.devcel.2011.12.007" + " - calculate general statistics\n" + ] + }, + { + "cell_type": "markdown", + "id": "fe931314", + "metadata": {}, + "source": [ + "- we import a data set from [Jahn et al. eLife 2018](https://doi.org/10.7554/eLife.69019) that is not really tidy yet\n", + "- it contains MS measurements of a protein in 4 different conditions and 5 growth rates\n", + "- replicate measurements are stored in columns R1 to R4, which we want to have in long format" ] }, { @@ -1020,10 +1030,7 @@ "metadata": {}, "outputs": [], "source": [ - "df = pd.read_csv(\n", - " \"../data/reeves_gradient_width_various_methods.csv\", comment=\"#\", header=[0, 1]\n", - ")\n", - "\n", + "df = pd.read_csv(\"../data/Jahn_eLife_2021.csv\")\n", "df.head()" ] }, @@ -1034,17 +1041,24 @@ "metadata": {}, "outputs": [], "source": [ - "# The first row of column headings contains the genotypes.\n", - "# The second row contains the staining/visualization method.\n", - "# The data give the computed gradient width as parametrized by\n", - "# sigma (see the original paper).\n", - "\n", - "df.columns.names = [\"genotype\", \"method\"]\n", - "df = pd.melt(df, value_name=\"gradient width\")\n", + "df = pd.melt(\n", + " df,\n", + " id_vars=[\"uniprot\", \"substrate\", \"growthrate\"],\n", + " var_name=\"replicate\",\n", + " value_name=\"abundance\",\n", + ")\n", "\n", "df.head()" ] }, + { + "cell_type": "markdown", + "id": "e716f135", + "metadata": {}, + "source": [ + "- optionally remove n/a values" + ] + }, { "cell_type": "code", "execution_count": null, @@ -1052,10 +1066,18 @@ "metadata": {}, "outputs": [], "source": [ - "# removing n/a values\n", + "\n", "df = df.dropna()" ] }, + { + "cell_type": "markdown", + "id": "8833505e", + "metadata": {}, + "source": [ + "- group by variables of choice and calculate summary statistics, i.e. mean, standard deviation" + ] + }, { "cell_type": "code", "execution_count": null, @@ -1063,7 +1085,7 @@ "metadata": {}, "outputs": [], "source": [ - "df.groupby([\"genotype\", \"method\"]).describe()" + "df.groupby([\"uniprot\", \"substrate\"]).describe()" ] }, { @@ -1337,7 +1359,7 @@ "metadata": { "celltoolbar": "Slideshow", "kernelspec": { - "display_name": ".venv (3.14.3)", + "display_name": "default", "language": "python", "name": "python3" }, @@ -1351,7 +1373,7 @@ "name": "python", "nbconvert_exporter": "python", "pygments_lexer": "ipython3", - "version": "3.14.3" + "version": "3.14.4" } }, "nbformat": 4, diff --git a/lessons/lesson_09.ipynb b/lessons/lesson_09.ipynb new file mode 100644 index 0000000..27f508e --- /dev/null +++ b/lessons/lesson_09.ipynb @@ -0,0 +1,635 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "id": "a60ff099", + "metadata": {}, + "source": [ + "# Lesson 09\n", + "\n", + "### In this lesson, we will learn about the following topics:\n", + "\n", + "- _very brief_ introduction to the **R language**\n", + "- basic objects and functions in R\n", + "- importing, manipulating and exporting tabular data in R\n", + "- all major concepts are similar to Python, we focus on the **differences** in syntax and behavior\n", + "\n", + "### Recap of previous lesson\n", + "\n", + "- biopython\n", + "- sequence objects and manipulation\n", + "- querying sequence databases such as NCBI\n" + ] + }, + { + "cell_type": "markdown", + "id": "09216b2a", + "metadata": {}, + "source": [ + "## Introduction to R\n", + "\n", + "- the following introduction is based on two major resources\n", + " - the [R for Data Science](https://r4ds.had.co.nz/) book by Hadley Wickham and Garrett Grolemund, which is an excellent resource for learning R\n", + " - the official [Introduction to R](https://cran.r-project.org/doc/manuals/r-release/R-intro.pdf) document on the R project website\n", + "\n", + "### What is R?\n", + "\n", + "- R is a programming language and software environment for statistical computing and graphics\n", + "- it was created by Ross Ihaka and Robert Gentleman in the early 1990s at the University of Auckland, New Zealand\n", + "- R is **widely used among statisticians**, data scientists, computational biologists, etc.\n", + "- its main strengths are **native support for data** manipulation, statistical analysis, and visualization\n", + "- R packages are distributed through the Comprehensive R Archive Network [CRAN](https://cran.r-project.org/) and [Bioconductor](https://bioconductor.org/)" + ] + }, + { + "cell_type": "markdown", + "id": "e1a481d1", + "metadata": {}, + "source": [ + "## R basics for Python learners\n", + "\n", + "If you already know the essentials of Python, most ideas in R will feel familiar:\n", + "\n", + "- **variables** store values\n", + "- values have **types** (numeric, character, logical, ...)\n", + "- you can use **loops and functions**\n", + "\n", + "One of the big differences to Python is that **R is vector-first**. Many operations are naturally applied to whole vectors at once.\n", + "\n", + "**Let's look at the basic data types in R**\n", + "\n", + "1. Core atomic data types (\"single\" values)\n", + "2. Vectors and type coercion\n", + "3. Lists and data frames" + ] + }, + { + "cell_type": "markdown", + "id": "f05ec619", + "metadata": {}, + "source": [ + "### Atomic data types\n", + "\n", + "- `double`, `integer`, `character`, `logical` correspond to:\n", + "- `float`, `int`, `str`, `bool` in Python\n", + "- variables are assigned with `<-` or, less commonly `=`\n", + "- everything can be `print()`ed, and many things can be inspected with `summary()`\n", + "- note the `c()` (concatenate) function which is the universal generator for vectors (non-nested lists)" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "25803319", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "x_num <- 3.14 # double (numeric floating point)\n", + "x_int <- 7L # integer (L suffix)\n", + "x_str <- \"hello\" # character\n", + "x_bool <- TRUE # logical (TRUE/FALSE, uppercase!)\n", + "\n", + "print(c(x_num, x_int, x_str, x_bool))\n" + ] + }, + { + "cell_type": "markdown", + "id": "2f8dc93b", + "metadata": {}, + "source": [ + "- inspecting types" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "dfbb36d2", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "typeof(x_num)\n", + "typeof(x_int)\n", + "typeof(x_str)\n", + "typeof(x_bool)" + ] + }, + { + "cell_type": "markdown", + "id": "e0070cbd", + "metadata": {}, + "source": [ + "- some things, like working with numbers, are similar to Python\n", + "- other things, like combining strings with `a + b`, `a * 3`, do not work" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "280c18cc", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "3 + 4\n", + "10 - 2\n", + "5 * 6\n", + "\n", + "# this does not work in R, unlike Python\n", + "try(expr = {\n", + " \"banana\" + \"split\" \n", + "})\n", + "\n" + ] + }, + { + "cell_type": "markdown", + "id": "a8fba684", + "metadata": {}, + "source": [ + "- **type conversions** are similar to Python and less strict\n", + "- for example, if numeric and character values are combined in a vector, the numeric values will be coerced to character" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "6866eae0", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "a = 3\n", + "a = as.character(a) # convert to string / character\n", + "print(c(a, typeof(a)))\n", + "\n", + "b = \"5\"\n", + "b = as.numeric(b) # convert to numeric\n", + "print(c(b, typeof(b)))" + ] + }, + { + "cell_type": "markdown", + "id": "69143b16", + "metadata": {}, + "source": [ + "### Vectors (non-nested lists)\n", + "\n", + "- very important data structure in R, stores values of same type\n", + "- R has no `dict` type, but vectors can be named to access values\n", + "- R works natively with vectors: applies functions to all elements automatically" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "b22e95f5", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "# numeric vector\n", + "v <- c(10, 20, 30, 40)\n", + "\n", + "# note how operations are applied to all elements, unlike python\n", + "v + 5\n", + "v * 2\n", + "v > 25" + ] + }, + { + "cell_type": "markdown", + "id": "b5d78146", + "metadata": {}, + "source": [ + "- indexing is easier in R than in Python (starts with `1` not `0`)\n", + "- almost all elements can be accessed by their position (index)\n", + "- arbitrary sequences of elements can be accessed by ranges (``:``)" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "590a1566", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "\n", + "v[1] # first element\n", + "v[2:3] # slice: elements 2 to 3\n", + "\n", + "names(v) = c(\"ten\", \"twenty\", \"thirty\", \"forty\")\n", + "v[\"twenty\"]\n" + ] + }, + { + "cell_type": "markdown", + "id": "144d36e4", + "metadata": {}, + "source": [ + "- missing values are handled natively and explicitly\n", + "- the universal missing value is `NA` (Not Available)" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "80cf953a", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "v_missing <- c(1, 2, NA, 4)\n", + "v_missing\n", + "mean(v_missing) # NA by default\n", + "mean(v_missing, na.rm = TRUE) # ignore NA\n" + ] + }, + { + "cell_type": "markdown", + "id": "96d76bfa", + "metadata": {}, + "source": [ + "- mixed-type vectors are always coerced to the \"lowest\" possible type" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "3f201f9a", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "mixed <- c(1, TRUE, 0)\n", + "mixed\n", + "typeof(mixed) # the logical is coerced to numeric (0 or 1)\n", + "\n", + "mixed2 <- c(1, TRUE, \"23\")\n", + "mixed2\n", + "typeof(mixed2) # logicals and numbers coerced to string/character\n" + ] + }, + { + "cell_type": "markdown", + "id": "b469bf1f", + "metadata": {}, + "source": [ + "### Lists\n", + "\n", + "- lists can store arbitrary objects of mixed types\n", + "- list elements can be named, unlike python, making them a mixture of list and dict\n", + "- to pick a single element of a list use double squared brackets `[[ ]]`, or the dollar shorthand `my_list$my_element`\n", + "- single brackets `[ ]` will return a list again\n" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "9957502c", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "my_list <- list(\n", + " species = \"Streptococcus pyogenes\",\n", + " n_genes = 1800,\n", + " is_model = TRUE,\n", + " strains = c(\"SF370\", \"M1T1\")\n", + ")\n", + "\n", + "my_list\n", + "my_list$species\n", + "my_list[[\"is_model\"]]\n", + "\n", + "my_list[[2]] # returns a number\n", + "my_list[2] # returns a length-1 list\n" + ] + }, + { + "cell_type": "markdown", + "id": "41f7322e", + "metadata": {}, + "source": [ + "### Data frames\n", + "\n", + "- Data frames store tabular data (like a `pandas` DataFrame)\n", + "- are natively supported and arguably the **most important data type in R**\n", + "- columns can store any type of object, but usually atomic (non-nestd) elements\n", + "- single columns must store **elements of the same type**\n" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "bcf26428", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "\n", + "df <- data.frame(\n", + " sample_id = c(\"S1\", \"S2\", \"S3\", \"S4\"),\n", + " condition = c(\"control\", \"control\", \"treated\", \"treated\"),\n", + " expression = c(8.2, 7.9, 10.5, 11.0),\n", + " stringsAsFactors = FALSE\n", + ")\n", + "\n", + "df\n", + "summary(df)\n", + "colnames(df)\n", + "rownames(df)\n" + ] + }, + { + "cell_type": "markdown", + "id": "3e872a62", + "metadata": {}, + "source": [ + "- data frames can be easily accessed and changed using column names or numeric indexing\n", + "- arbitrary subsets of data frames are selected using `df[row, col]` syntax" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "398ad07c", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "# get one column (returns vector of elements)\n", + "df$expression\n", + "\n", + "# filter data frame\n", + "df[df$expression > 9, ]\n", + "\n", + "# filter and sub-select columns using df[row, col]\n", + "df[df$condition == \"treated\", c(\"sample_id\", \"expression\")]" + ] + }, + { + "cell_type": "markdown", + "id": "8058298e", + "metadata": {}, + "source": [ + "## Control flow in R\n", + "\n", + "- R has the same control-flow ideas as Python, with slightly different syntax:\n", + " - `if (...) { ... } else { ... }`\n", + " - `for (x in vector) { ... }`\n", + " - `while (...) { ... }`\n", + "\n", + "- conditions/iterators are wrapped in round, and function bodies in curly braces" + ] + }, + { + "cell_type": "markdown", + "id": "39b387e3", + "metadata": {}, + "source": [ + "**if-else** condition" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "e0b0088d", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "promoter <- \"AGCTTGACAGACGAAGATTATAATGCAGCG\"\n", + "\n", + "if (nchar(promoter) > 30) {\n", + " print(\"long promoter\")\n", + "} else {\n", + " print(\"short promoter\")\n", + "}" + ] + }, + { + "cell_type": "markdown", + "id": "4c522c4d", + "metadata": {}, + "source": [ + "**for-loop** and **while-loop**" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "4b188af3", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "\n", + "sigma_factors <- c(\"sigma72\", \"sigma54\", \"sigma28\")\n", + "for (s in sigma_factors) {\n", + " print(paste(\"Sigma factor:\", gsub(\"sigma\", \"\", s)))\n", + "}\n", + "\n", + "count <- 1\n", + "while (count <= 3) {\n", + " print(count)\n", + " count <- count + 1\n", + "}" + ] + }, + { + "cell_type": "markdown", + "id": "a2080ac1", + "metadata": {}, + "source": [ + "## Functions in R\n", + "\n", + "- functions are defined with `fname <- function(...) { ... }` and can return values with `return(...)`\n", + "- in the example, we calculate the **z-score** which indicates by how many standard deviations a value deviates from the population mean" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "f0672dce", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "z_score <- function(x) {\n", + " mu = mean(x)\n", + " sigma = sd(x)\n", + " return((x - mu) / sigma)\n", + "}\n", + "\n", + "z_score(rnorm(10)) # input: 10 random numbers from normal distribution\n" + ] + }, + { + "cell_type": "markdown", + "id": "886e1da5", + "metadata": {}, + "source": [ + "- function with mandatory and optional argument (can be omitted in call)\n" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "c6b5bc37", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "\n", + "rescale_rpm <- function(x, total_reads, scaling = 1e6) {\n", + " round((x / total_reads) * scaling, 1)\n", + "}\n", + "\n", + "reads <- c(2534, 5788, 13221, 784, 6298)\n", + "total_reads <- 7.5e7\n", + "rescale_rpm(reads, total_reads)" + ] + }, + { + "cell_type": "markdown", + "id": "cb3953f2", + "metadata": {}, + "source": [ + "## Quick recap\n", + "\n", + "Key points to remember:\n", + "\n", + "- R uses `TRUE`/`FALSE`, not `True`/`False`\n", + "- R indexing starts at 1\n", + "- vectors and data frames are important data types, and operations are often vectorized\n", + "- `NA` represents missing data\n", + "- functions and loops do not use indentation, but curly braces `{}` for their bodies\n" + ] + }, + { + "cell_type": "markdown", + "id": "71ed706c", + "metadata": {}, + "source": [ + "\n", + "## Exercises\n", + "\n", + "\n", + "- compute mean and standard deviation of the following numeric vector\n", + "- note: use `mean()` and `sd()` functions, and handle missing values" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "f3ddcbac", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "my_vec = c(3, 6, 12, 34, 2, 15, 26, NA)\n" + ] + }, + { + "cell_type": "markdown", + "id": "82880baa", + "metadata": {}, + "source": [ + "- you get the following data frame with gene expression values for 3 genes across 4 samples\n", + "- calculate the mean expression of treatment and control for each gene separately\n", + "- use a function and a for-loop\n", + "- NOTE 1: this data frame is already in the convenient **long format** where all observations are spread on individual rows, not columns\n", + "- NOTE 2: there are *much more efficient* ways to achieve this in R that we will learn about next lesson" + ] + }, + { + "cell_type": "code", + "execution_count": null, + "id": "c9191d86", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [], + "source": [ + "# we use repeat function `rep(x, ...)` to fill the data frame with values\n", + "df <- data.frame(\n", + " gene = rep(c(\"tetR\", \"tetA\", \"tetB\"), each = 4),\n", + " condition = rep(c(\"treatment\", \"control\"), times = 6),\n", + " replicate = rep(c(1, 1, 2, 2), times = 3),\n", + " expression = c(10, 20, 30, 15, 25, NA, 12, 22, 32, 14, 24, 34)\n", + ")\n" + ] + } + ], + "metadata": { + "celltoolbar": "Slideshow", + "kernelspec": { + "display_name": "R", + "language": "R", + "name": "ir" + }, + "language_info": { + "codemirror_mode": "r", + "file_extension": ".r", + "mimetype": "text/x-r-source", + "name": "R", + "pygments_lexer": "r", + "version": "4.5.3" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +} diff --git a/pixi.lock b/pixi.lock index 899310d..b83b1d9 100644 --- a/pixi.lock +++ b/pixi.lock @@ -9,56 +9,339 @@ environments: packages: linux-64: - conda: https://conda.anaconda.org/conda-forge/linux-64/_openmp_mutex-4.5-20_gnu.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/_python_abi3_support-1.0-hd8ed1ab_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/_r-mutex-1.0.1-anacondar_1.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/noarch/anyio-4.13.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/argon2-cffi-25.1.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/argon2-cffi-bindings-25.1.0-py313h07c4f96_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/arrow-1.4.0-pyhcf101f3_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/asttokens-3.0.1-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/async-lru-2.3.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/attrs-26.1.0-pyhcf101f3_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/autopep8-2.3.2-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/babel-2.18.0-pyhcf101f3_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/backports.zstd-1.3.0-py313h18e8e13_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/beautifulsoup4-4.14.3-pyha770c72_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/binutils_impl_linux-64-2.45.1-default_hfdba357_102.conda - conda: https://conda.anaconda.org/conda-forge/noarch/black-26.3.1-pyh866005b_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/bleach-6.3.0-pyhcf101f3_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/bleach-with-css-6.3.0-hbca2aae_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/brotli-python-1.2.0-py313hf159716_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/bwidget-1.10.1-ha770c72_1.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/bzip2-1.0.8-hda65f42_9.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/c-ares-1.34.6-hb03c661_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/ca-certificates-2026.4.22-hbd8a1cb_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/cached-property-1.5.2-hd8ed1ab_1.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/noarch/cached_property-1.5.2-pyha770c72_1.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/linux-64/cairo-1.18.4-he90730b_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/certifi-2026.4.22-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/cffi-2.0.0-py313hf46b229_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/charset-normalizer-3.4.7-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/click-8.3.2-pyhc90fa1f_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/comm-0.2.3-pyhe01879c_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/cpython-3.13.13-py313hd8ed1ab_100.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/curl-8.19.0-hcf29cc6_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/debugpy-1.8.20-py313h5d5ffb9_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/decorator-5.2.1-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/defusedxml-0.7.1-pyhd8ed1ab_0.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/noarch/exceptiongroup-1.3.1-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/executing-2.2.1-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/font-ttf-dejavu-sans-mono-2.37-hab24e00_0.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/noarch/font-ttf-inconsolata-3.000-h77eed37_0.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/noarch/font-ttf-source-code-pro-2.038-h77eed37_0.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/noarch/font-ttf-ubuntu-0.83-h77eed37_3.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/fontconfig-2.17.1-h27c8c51_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/fonts-conda-ecosystem-1-0.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/noarch/fonts-conda-forge-1-hc364b38_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/fqdn-1.5.1-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/fribidi-1.0.16-hb03c661_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/gcc_impl_linux-64-15.2.0-he420e7e_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/gfortran_impl_linux-64-15.2.0-h281d09f_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/graphite2-1.3.14-hecca717_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/gsl-2.7-he838d99_0.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/linux-64/gxx_impl_linux-64-15.2.0-hda75c37_18.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/h11-0.16.0-pyhcf101f3_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/h2-4.3.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/harfbuzz-14.2.0-h6083320_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/hpack-4.1.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/httpcore-1.0.9-pyh29332c3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/httpx-0.28.1-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/hyperframe-6.1.0-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/icu-78.3-h33c6efd_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/idna-3.13-pyhcf101f3_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/importlib-metadata-8.8.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/importlib_resources-7.1.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/ipykernel-7.2.0-pyha191276_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/ipython-9.12.0-pyhecfbec7_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/ipython_pygments_lexers-1.1.1-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/ipywidgets-8.1.8-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/isoduration-20.11.0-pyhd8ed1ab_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/jedi-0.19.2-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jinja2-3.1.6-pyhcf101f3_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/json5-0.14.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jsonpointer-3.1.1-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jsonschema-4.26.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jsonschema-specifications-2025.9.1-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jsonschema-with-format-nongpl-4.26.0-hcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyter-1.1.1-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyter-lsp-2.3.1-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_client-8.8.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_console-6.6.3-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_core-5.9.1-pyhc90fa1f_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_events-0.12.1-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_server-2.17.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_server_terminals-0.5.4-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyterlab-4.5.6-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyterlab_pygments-0.3.0-pyhd8ed1ab_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyterlab_server-2.28.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/jupyterlab_widgets-3.0.16-pyhcf101f3_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/kernel-headers_linux-64-4.18.0-he073ed8_9.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/keyutils-1.6.3-hb9d3cd8_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/krb5-1.22.2-ha1258a1_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/lark-1.3.1-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/ld_impl_linux-64-2.45.1-default_hbd61a6d_102.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/lerc-4.1.0-hdb68285_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libblas-3.11.0-6_h4a7cf45_openblas.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libcblas-3.11.0-6_h0358290_openblas.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libcurl-8.19.0-hcf29cc6_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libdeflate-1.25-h17f619e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libedit-3.1.20250104-pl5321h7949ede_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libev-4.33-hd590300_2.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libexpat-2.7.5-hecca717_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libffi-3.5.2-h3435931_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libfreetype-2.14.3-ha770c72_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libfreetype6-2.14.3-h73754d4_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libgcc-15.2.0-he0feb66_18.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/libgcc-devel_linux-64-15.2.0-hcc6f6b0_118.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libgcc-ng-15.2.0-h69a702a_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libgfortran-15.2.0-h69a702a_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libgfortran-ng-15.2.0-h69a702a_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libgfortran5-15.2.0-h68bc16d_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libglib-2.86.4-h6548e54_1.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libgomp-15.2.0-he0feb66_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libiconv-1.18-h3b78370_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libjpeg-turbo-3.1.4.1-hb03c661_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/liblapack-3.11.0-6_h47877c9_openblas.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/liblzma-5.8.3-hb03c661_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libmpdec-4.0.0-hb03c661_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libnghttp2-1.68.1-h877daf1_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libopenblas-0.3.32-pthreads_h94d23a6_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libpng-1.6.58-h421ea60_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libsanitizer-15.2.0-h90f66d4_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libsodium-1.0.21-h280c20c_3.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libsqlite-3.53.0-hf4e2dac_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libssh2-1.11.1-hcf80075_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-15.2.0-h934c35e_18.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/libstdcxx-devel_linux-64-15.2.0-hd446a21_118.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-ng-15.2.0-hdf11a46_18.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libtiff-4.7.1-h9d88235_1.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libuuid-2.42-h5347b49_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libwebp-base-1.6.0-hd42ef1d_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libxcb-1.17.0-h8a09558_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libxml2-16-2.15.3-hca6bf5a_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/libxml2-2.15.3-h49c6c72_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/libzlib-1.3.2-h25fd6f3_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/make-4.4.1-hb9d3cd8_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/markupsafe-3.0.3-pyh7db6752_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/matplotlib-inline-0.2.1-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/mistune-3.2.0-pyhcf101f3_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/mypy_extensions-1.1.0-pyha770c72_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/nbclient-0.10.4-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/nbconvert-core-7.17.1-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/nbformat-5.10.4-pyhd8ed1ab_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/nbqa-1.9.0-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/ncurses-6.5-h2d0b736_3.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/nest-asyncio-1.6.0-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/notebook-7.5.5-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/notebook-shim-0.2.4-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/numpy-2.4.3-py313hf6604e3_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/openssl-3.6.2-h35e630c_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/overrides-7.7.0-pyhd8ed1ab_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/packaging-26.1-pyhc364b38_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/pandas-3.0.2-py313hbfd7664_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/pandoc-3.9.0.2-ha770c72_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/pandocfilters-1.5.0-pyhd8ed1ab_0.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/linux-64/pango-1.56.4-hda50119_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/parso-0.8.6-pyhcf101f3_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/pathspec-1.0.4-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/pcre2-10.47-haa7fec5_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/pexpect-4.9.0-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/pixman-0.46.4-h54a6638_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/platformdirs-4.9.6-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/prometheus_client-0.25.0-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/prompt-toolkit-3.0.52-pyha770c72_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/prompt_toolkit-3.0.52-hd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/psutil-7.2.2-py313h54dd161_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/pthread-stubs-0.4-hb9d3cd8_1002.conda - conda: https://conda.anaconda.org/conda-forge/noarch/ptyprocess-0.7.0-pyhd8ed1ab_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/pure_eval-0.2.3-pyhd8ed1ab_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/pycodestyle-2.14.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/pycparser-2.22-pyh29332c3_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/pygments-2.20.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/pysocks-1.7.1-pyha55dd90_7.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/python-3.13.13-h6add32d_100_cp313.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/python-dateutil-2.9.0.post0-pyhe01879c_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/python-fastjsonschema-2.21.2-pyhe01879c_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/python-gil-3.13.13-h4df99d1_100.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/python-json-logger-2.0.7-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/python-tzdata-2026.1-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/python_abi-3.13-8_cp313.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/pytokens-0.4.1-py313h54dd161_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/pyyaml-6.0.3-pyh7db6752_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/pyzmq-27.1.0-py312hda471dd_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-askpass-1.2.1-r45h54b55ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-assertthat-0.2.1-r45hc72bb7e_6.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-backports-1.5.1-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-base-4.5.3-h15dba0b_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-base64enc-0.1_6-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-bit-4.6.0-r45h54b55ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-bit64-4.8.0-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-blob-1.3.0-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-broom-1.0.12-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-bslib-0.10.0-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-cachem-1.1.0-r45h54b55ab_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-callr-3.7.6-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-cellranger-1.1.0-r45hc72bb7e_1008.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-cli-3.6.6-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-clipr-0.8.0-r45hc72bb7e_4.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-colorspace-2.1_2-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-conflicted-1.2.0-r45h785f33e_3.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-cpp11-0.5.4-r45h785f33e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-crayon-1.5.3-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-curl-7.0.0-r45h10955f1_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-data.table-1.17.8-r45h1c8cec4_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-dbi-1.3.0-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-dbplyr-2.5.2-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-digest-0.6.39-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-dplyr-1.2.1-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-dtplyr-1.3.3-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-ellipsis-0.3.3-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-evaluate-1.0.5-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-fansi-1.0.7-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-farver-2.1.2-r45h3697838_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-fastmap-1.2.0-r45h3697838_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-fontawesome-0.5.3-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-forcats-1.0.1-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-fs-1.6.7-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-gargle-1.6.1-r45h785f33e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-generics-0.1.4-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-ggplot2-4.0.3-r45h785f33e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-glue-1.8.1-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-googledrive-2.1.2-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-googlesheets4-1.1.2-r45h785f33e_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-gtable-0.3.6-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-haven-2.5.5-r45h6d565e7_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-highr-0.12-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-hms-1.1.4-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-htmltools-0.5.9-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-httr-1.4.8-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-ids-1.0.1-r45hc72bb7e_5.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-irdisplay-1.1-r45hd8ed1ab_4.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-irkernel-1.3.2-r45h785f33e_3.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-isoband-0.3.0-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-jquerylib-0.1.4-r45hc72bb7e_4.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-jsonlite-2.0.0-r45h54b55ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-knitr-1.51-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-labeling-0.4.3-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-lifecycle-1.0.5-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-lubridate-1.9.5-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-magrittr-2.0.5-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-memoise-2.0.1-r45hc72bb7e_4.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-mime-0.13-r45h54b55ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-modelr-0.1.11-r45hc72bb7e_3.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-munsell-0.5.1-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-openssl-2.4.0-r45h68c19f5_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-pbdzmq-0.3_14-r45hded8526_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-pillar-1.11.1-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-pkgconfig-2.0.3-r45hc72bb7e_5.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-prettyunits-1.2.0-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-processx-3.9.0-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-progress-1.2.3-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-ps-1.9.2-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-purrr-1.2.2-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-r6-2.6.1-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-ragg-1.5.2-r45h9f1dc4d_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-rappdirs-0.3.4-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-rcolorbrewer-1.1_3-r45h785f33e_4.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-readr-2.2.0-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-readxl-1.4.5-r45h10e25cc_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-rematch-2.0.0-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-rematch2-2.1.2-r45hc72bb7e_5.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-repr-1.1.7-r45h785f33e_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-reprex-2.1.1-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-rlang-1.2.0-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-rmarkdown-2.31-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-rstudioapi-0.18.0-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-rvest-1.0.5-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-s7-0.2.2-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-sass-0.4.10-r45h3697838_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-scales-1.4.0-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-selectr-0.5_1-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-stringi-1.8.7-r45h3d52c89_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-stringr-1.6.0-r45h785f33e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-sys-3.4.3-r45h54b55ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-systemfonts-1.3.2-r45h74f4acd_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-textshaping-1.0.5-r45h74f4acd_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-tibble-3.3.1-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-tidyr-1.3.2-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-tidyselect-1.2.1-r45hc72bb7e_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-tidyverse-2.0.0-r45h785f33e_3.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-timechange-0.4.0-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-tinytex-0.59-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-tzdb-0.5.0-r45h3697838_2.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-utf8-1.2.6-r45h54b55ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-uuid-1.2_2-r45h54b55ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-vctrs-0.7.3-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-viridislite-0.4.3-r45hc72bb7e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-vroom-1.7.1-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/r-withr-3.0.2-r45hc72bb7e_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-xfun-0.57-r45h3697838_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-xml2-1.5.2-r45he78afff_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/r-yaml-2.3.12-r45h54b55ab_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/readline-8.3-h853b02a_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/referencing-0.37.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/requests-2.33.1-pyhcf101f3_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/rfc3339-validator-0.1.4-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/rfc3986-validator-0.1.1-pyh9f0ad1d_0.tar.bz2 + - conda: https://conda.anaconda.org/conda-forge/noarch/rfc3987-syntax-1.1.0-pyhe01879c_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/rpds-py-0.30.0-py313h843e2db_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/sed-4.10-h19d0853_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/send2trash-2.1.0-pyha191276_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/setuptools-82.0.1-pyh332efcf_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/six-1.17.0-pyhe01879c_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/sniffio-1.3.1-pyhd8ed1ab_2.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/soupsieve-2.8.3-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/stack_data-0.6.3-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/sysroot_linux-64-2.28-h4ee821c_9.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/terminado-0.18.1-pyhc90fa1f_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/tinycss2-1.4.0-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/tk-8.6.13-noxft_h366c992_103.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/tktable-2.10-h5a7a40f_8.conda - conda: https://conda.anaconda.org/conda-forge/noarch/tokenize-rt-6.2.0-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/tomli-2.4.1-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/tornado-6.5.5-py313h07c4f96_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/traitlets-5.14.3-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/typing-extensions-4.15.0-h396c80c_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/typing_extensions-4.15.0-pyhcf101f3_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/typing_utils-0.1.0-pyhd8ed1ab_1.conda - conda: https://conda.anaconda.org/conda-forge/noarch/tzdata-2025c-hc9c84f9_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/uri-template-1.3.0-pyhd8ed1ab_1.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/urllib3-2.6.3-pyhd8ed1ab_0.conda - conda: https://conda.anaconda.org/conda-forge/noarch/wcwidth-0.6.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/webcolors-25.10.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/webencodings-0.5.1-pyhd8ed1ab_3.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/websocket-client-1.9.0-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/noarch/widgetsnbextension-4.0.15-pyhd8ed1ab_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libice-1.1.2-hb9d3cd8_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libsm-1.2.6-he73a12e_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libx11-1.8.13-he1eb515_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxau-1.0.12-hb03c661_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxdmcp-1.1.5-hb03c661_1.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxext-1.3.7-hb03c661_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxrender-0.9.12-hb9d3cd8_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxt-1.3.1-hb9d3cd8_0.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/yaml-0.2.5-h280c20c_3.conda + - conda: https://conda.anaconda.org/conda-forge/linux-64/zeromq-4.3.5-h41580af_10.conda - conda: https://conda.anaconda.org/conda-forge/noarch/zipp-3.23.1-pyhcf101f3_0.conda - conda: https://conda.anaconda.org/conda-forge/linux-64/zstd-1.5.7-hb78ec9c_6.conda packages: @@ -75,6 +358,77 @@ packages: license_family: BSD size: 28948 timestamp: 1770939786096 +- conda: https://conda.anaconda.org/conda-forge/noarch/_python_abi3_support-1.0-hd8ed1ab_2.conda + sha256: a3967b937b9abf0f2a99f3173fa4630293979bd1644709d89580e7c62a544661 + md5: aaa2a381ccc56eac91d63b6c1240312f + depends: + - cpython + - python-gil + license: MIT + license_family: MIT + size: 8191 + timestamp: 1744137672556 +- conda: https://conda.anaconda.org/conda-forge/noarch/_r-mutex-1.0.1-anacondar_1.tar.bz2 + sha256: e58f9eeb416b92b550e824bcb1b9fb1958dee69abfe3089dfd1a9173e3a0528a + md5: 19f9db5f4f1b7f5ef5f6d67207f25f38 + license: BSD + size: 3566 + timestamp: 1562343890778 +- conda: https://conda.anaconda.org/conda-forge/noarch/anyio-4.13.0-pyhcf101f3_0.conda + sha256: f09aed24661cd45ba54a43772504f05c0698248734f9ae8cd289d314ac89707e + md5: af2df4b9108808da3dc76710fe50eae2 + depends: + - exceptiongroup >=1.0.2 + - idna >=2.8 + - python >=3.10 + - typing_extensions >=4.5 + - python + constrains: + - trio >=0.32.0 + - uvloop >=0.22.1 + - winloop >=0.2.3 + license: MIT + license_family: MIT + size: 146764 + timestamp: 1774359453364 +- conda: https://conda.anaconda.org/conda-forge/noarch/argon2-cffi-25.1.0-pyhd8ed1ab_0.conda + sha256: bea62005badcb98b1ae1796ec5d70ea0fc9539e7d59708ac4e7d41e2f4bb0bad + md5: 8ac12aff0860280ee0cff7fa2cf63f3b + depends: + - argon2-cffi-bindings + - python >=3.9 + - typing-extensions + constrains: + - argon2_cffi ==999 + license: MIT + license_family: MIT + size: 18715 + timestamp: 1749017288144 +- conda: https://conda.anaconda.org/conda-forge/linux-64/argon2-cffi-bindings-25.1.0-py313h07c4f96_2.conda + sha256: ad188ccc06a06c633dc124b09e9e06fb9df4c32ffc38acc96ecc86e506062090 + md5: 27bbec9f2f3a15d32b60ec5734f5b41c + depends: + - __glibc >=2.17,<3.0.a0 + - cffi >=1.0.1 + - libgcc >=14 + - python >=3.13,<3.14.0a0 + - python_abi 3.13.* *_cp313 + license: MIT + license_family: MIT + size: 35943 + timestamp: 1762509452935 +- conda: https://conda.anaconda.org/conda-forge/noarch/arrow-1.4.0-pyhcf101f3_0.conda + sha256: 792da8131b1b53ff667bd6fc617ea9087b570305ccb9913deb36b8e12b3b5141 + md5: 85c4f19f377424eafc4ed7911b291642 + depends: + - python >=3.10 + - python-dateutil >=2.7.0 + - python-tzdata + - python + license: Apache-2.0 + license_family: APACHE + size: 113854 + timestamp: 1760831179410 - conda: https://conda.anaconda.org/conda-forge/noarch/asttokens-3.0.1-pyhd8ed1ab_0.conda sha256: ee4da0f3fe9d59439798ee399ef3e482791e48784873d546e706d0935f9ff010 md5: 9673a61a297b00016442e022d689faa6 @@ -86,6 +440,27 @@ packages: license_family: Apache size: 28797 timestamp: 1763410017955 +- conda: https://conda.anaconda.org/conda-forge/noarch/async-lru-2.3.0-pyhcf101f3_0.conda + sha256: ea8486637cfb89dc26dc9559921640cd1d5fd37e5e02c33d85c94572139f2efe + md5: b85e84cb64c762569cc1a760c2327e0a + depends: + - python >=3.10 + - typing_extensions >=4.0.0 + - python + license: MIT + license_family: MIT + size: 22949 + timestamp: 1773926359134 +- conda: https://conda.anaconda.org/conda-forge/noarch/attrs-26.1.0-pyhcf101f3_0.conda + sha256: 1b6124230bb4e571b1b9401537ecff575b7b109cc3a21ee019f65e083b8399ab + md5: c6b0543676ecb1fb2d7643941fe375f2 + depends: + - python >=3.10 + - python + license: MIT + license_family: MIT + size: 64927 + timestamp: 1773935801332 - conda: https://conda.anaconda.org/conda-forge/noarch/autopep8-2.3.2-pyhd8ed1ab_0.conda sha256: 1dc8ba2892c76c7bdd6518e3684b88710f4a985ebfc1d4f588478569391d300b md5: 08ee18d78273baa3ed4cef5a8a58d79a @@ -98,6 +473,52 @@ packages: license_family: MIT size: 46233 timestamp: 1736871757804 +- conda: https://conda.anaconda.org/conda-forge/noarch/babel-2.18.0-pyhcf101f3_1.conda + sha256: a14a9ad02101aab25570543a59c5193043b73dc311a25650134ed9e6cb691770 + md5: f1976ce927373500cc19d3c0b2c85177 + depends: + - python >=3.10 + - python + constrains: + - pytz >=2015.7 + license: BSD-3-Clause + license_family: BSD + size: 7684321 + timestamp: 1772555330347 +- conda: https://conda.anaconda.org/conda-forge/linux-64/backports.zstd-1.3.0-py313h18e8e13_0.conda + sha256: 9552afbec37c4d8d0e83a5c4c6b3c7f4b8785f935094ce3881e0a249045909ce + md5: d9e90792551a527200637e23a915dd79 + depends: + - python + - libgcc >=14 + - __glibc >=2.17,<3.0.a0 + - python_abi 3.13.* *_cp313 + - zstd >=1.5.7,<1.6.0a0 + license: BSD-3-Clause AND MIT AND EPL-2.0 + size: 240943 + timestamp: 1767044981366 +- conda: https://conda.anaconda.org/conda-forge/noarch/beautifulsoup4-4.14.3-pyha770c72_0.conda + sha256: bf1e71c3c0a5b024e44ff928225a0874fc3c3356ec1a0b6fe719108e6d1288f6 + md5: 5267bef8efea4127aacd1f4e1f149b6e + depends: + - python >=3.10 + - soupsieve >=1.2 + - typing-extensions + license: MIT + license_family: MIT + size: 90399 + timestamp: 1764520638652 +- conda: https://conda.anaconda.org/conda-forge/linux-64/binutils_impl_linux-64-2.45.1-default_hfdba357_102.conda + sha256: 0a7d405064f53b9d91d92515f1460f7906ee5e8523f3cd8973430e81219f4917 + md5: 8165352fdce2d2025bf884dc0ee85700 + depends: + - ld_impl_linux-64 2.45.1 default_hbd61a6d_102 + - sysroot_linux-64 + - zstd >=1.5.7,<1.6.0a0 + license: GPL-3.0-only + license_family: GPL + size: 3661455 + timestamp: 1774197460085 - conda: https://conda.anaconda.org/conda-forge/noarch/black-26.3.1-pyh866005b_0.conda sha256: 671b78df3fd288e4c99762d9a1b0391b70be2c7a46df564d6e6b3862db2ec799 md5: c7e43448266209d766a229cada982884 @@ -113,6 +534,50 @@ packages: license_family: MIT size: 171751 timestamp: 1773315364851 +- conda: https://conda.anaconda.org/conda-forge/noarch/bleach-6.3.0-pyhcf101f3_1.conda + sha256: f8ff1f98423674278964a46c93a1766f9e91960d44efd91c6c3ed56a33813f46 + md5: 7c5ebdc286220e8021bf55e6384acd67 + depends: + - python >=3.10 + - webencodings + - python + constrains: + - tinycss2 >=1.1.0,<1.5 + license: Apache-2.0 AND MIT + size: 142008 + timestamp: 1770719370680 +- conda: https://conda.anaconda.org/conda-forge/noarch/bleach-with-css-6.3.0-hbca2aae_1.conda + sha256: 7c07a865e5e4cca233cc4e0eb3f0f5ff6c90776461687b4fb0b1764133e1fd61 + md5: f11a319b9700b203aa14c295858782b6 + depends: + - bleach ==6.3.0 pyhcf101f3_1 + - tinycss2 + license: Apache-2.0 AND MIT + size: 4409 + timestamp: 1770719370682 +- conda: https://conda.anaconda.org/conda-forge/linux-64/brotli-python-1.2.0-py313hf159716_1.conda + sha256: dadec2879492adede0a9af0191203f9b023f788c18efd45ecac676d424c458ae + md5: 6c4d3597cf43f3439a51b2b13e29a4ba + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - python >=3.13,<3.14.0a0 + - python_abi 3.13.* *_cp313 + constrains: + - libbrotlicommon 1.2.0 hb03c661_1 + license: MIT + license_family: MIT + size: 367721 + timestamp: 1764017371123 +- conda: https://conda.anaconda.org/conda-forge/linux-64/bwidget-1.10.1-ha770c72_1.conda + sha256: c88dd33c89b33409ebcd558d78fdc66a63c18f8b06e04d170668ffb6c8ecfabd + md5: 983b92277d78c0d0ec498e460caa0e6d + depends: + - tk + license: TCL + size: 129594 + timestamp: 1750261567920 - conda: https://conda.anaconda.org/conda-forge/linux-64/bzip2-1.0.8-hda65f42_9.conda sha256: 0b75d45f0bba3e95dc693336fa51f40ea28c980131fec438afb7ce6118ed05f6 md5: d2ffd7602c02f2b316fd921d39876885 @@ -123,6 +588,16 @@ packages: license_family: BSD size: 260182 timestamp: 1771350215188 +- conda: https://conda.anaconda.org/conda-forge/linux-64/c-ares-1.34.6-hb03c661_0.conda + sha256: cc9accf72fa028d31c2a038460787751127317dcfa991f8d1f1babf216bb454e + md5: 920bb03579f15389b9e512095ad995b7 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + license: MIT + license_family: MIT + size: 207882 + timestamp: 1765214722852 - conda: https://conda.anaconda.org/conda-forge/noarch/ca-certificates-2026.4.22-hbd8a1cb_0.conda sha256: c9dbcc8039a52023660d6d1bbf87594a93dd69c6ac5a2a44323af2c92976728d md5: e18ad67cf881dcadee8b8d9e2f8e5f73 @@ -131,6 +606,82 @@ packages: license: ISC size: 131039 timestamp: 1776865545798 +- conda: https://conda.anaconda.org/conda-forge/noarch/cached-property-1.5.2-hd8ed1ab_1.tar.bz2 + noarch: python + sha256: 561e6660f26c35d137ee150187d89767c988413c978e1b712d53f27ddf70ea17 + md5: 9b347a7ec10940d3f7941ff6c460b551 + depends: + - cached_property >=1.5.2,<1.5.3.0a0 + license: BSD-3-Clause + license_family: BSD + size: 4134 + timestamp: 1615209571450 +- conda: https://conda.anaconda.org/conda-forge/noarch/cached_property-1.5.2-pyha770c72_1.tar.bz2 + sha256: 6dbf7a5070cc43d90a1e4c2ec0c541c69d8e30a0e25f50ce9f6e4a432e42c5d7 + md5: 576d629e47797577ab0f1b351297ef4a + depends: + - python >=3.6 + license: BSD-3-Clause + license_family: BSD + size: 11065 + timestamp: 1615209567874 +- conda: https://conda.anaconda.org/conda-forge/linux-64/cairo-1.18.4-he90730b_1.conda + sha256: 06525fa0c4e4f56e771a3b986d0fdf0f0fc5a3270830ee47e127a5105bde1b9a + md5: bb6c4808bfa69d6f7f6b07e5846ced37 + depends: + - __glibc >=2.17,<3.0.a0 + - fontconfig >=2.15.0,<3.0a0 + - fonts-conda-ecosystem + - icu >=78.1,<79.0a0 + - libexpat >=2.7.3,<3.0a0 + - libfreetype >=2.14.1 + - libfreetype6 >=2.14.1 + - libgcc >=14 + - libglib >=2.86.3,<3.0a0 + - libpng >=1.6.53,<1.7.0a0 + - libstdcxx >=14 + - libxcb >=1.17.0,<2.0a0 + - libzlib >=1.3.1,<2.0a0 + - pixman >=0.46.4,<1.0a0 + - xorg-libice >=1.1.2,<2.0a0 + - xorg-libsm >=1.2.6,<2.0a0 + - xorg-libx11 >=1.8.12,<2.0a0 + - xorg-libxext >=1.3.6,<2.0a0 + - xorg-libxrender >=0.9.12,<0.10.0a0 + license: LGPL-2.1-only or MPL-1.1 + size: 989514 + timestamp: 1766415934926 +- conda: https://conda.anaconda.org/conda-forge/noarch/certifi-2026.4.22-pyhd8ed1ab_0.conda + sha256: 989db6e5957c4b44fa600c68c681ec2f36a55e48f7c7f1c073d5e91caa8cd878 + md5: 929471569c93acefb30282a22060dcd5 + depends: + - python >=3.10 + license: ISC + size: 135656 + timestamp: 1776866680878 +- conda: https://conda.anaconda.org/conda-forge/linux-64/cffi-2.0.0-py313hf46b229_1.conda + sha256: 2162a91819945c826c6ef5efe379e88b1df0fe9a387eeba23ddcf7ebeacd5bd6 + md5: d0616e7935acab407d1543b28c446f6f + depends: + - __glibc >=2.17,<3.0.a0 + - libffi >=3.5.2,<3.6.0a0 + - libgcc >=14 + - pycparser + - python >=3.13,<3.14.0a0 + - python_abi 3.13.* *_cp313 + license: MIT + license_family: MIT + size: 298357 + timestamp: 1761202966461 +- conda: https://conda.anaconda.org/conda-forge/noarch/charset-normalizer-3.4.7-pyhd8ed1ab_0.conda + sha256: 3f9483d62ce24ecd063f8a5a714448445dc8d9e201147c46699fc0033e824457 + md5: a9167b9571f3baa9d448faa2139d1089 + depends: + - python >=3.10 + license: MIT + license_family: MIT + size: 58872 + timestamp: 1775127203018 - conda: https://conda.anaconda.org/conda-forge/noarch/click-8.3.2-pyhc90fa1f_0.conda sha256: 526d434cf5390310f40f34ea6ec4f0c225cdf1e419010e624d399b13b2059f0f md5: 4d18bc3af7cfcea97bd817164672a08c @@ -142,6 +693,55 @@ packages: license_family: BSD size: 98253 timestamp: 1775578217828 +- conda: https://conda.anaconda.org/conda-forge/noarch/comm-0.2.3-pyhe01879c_0.conda + sha256: 576a44729314ad9e4e5ebe055fbf48beb8116b60e58f9070278985b2b634f212 + md5: 2da13f2b299d8e1995bafbbe9689a2f7 + depends: + - python >=3.9 + - python + license: BSD-3-Clause + license_family: BSD + size: 14690 + timestamp: 1753453984907 +- conda: https://conda.anaconda.org/conda-forge/noarch/cpython-3.13.13-py313hd8ed1ab_100.conda + noarch: generic + sha256: 836b92c209d4b6b9fb28bd51bd788b22a0c5492ae95eec2724e65a15ed4ab2e1 + md5: 3a8a8b87e72f95b54689fb588e154ec9 + depends: + - python >=3.13,<3.14.0a0 + - python_abi * *_cp313 + license: Python-2.0 + size: 48530 + timestamp: 1775613723457 +- conda: https://conda.anaconda.org/conda-forge/linux-64/curl-8.19.0-hcf29cc6_0.conda + sha256: 783b7525ef535b67236c2773f5553b111ee5258ad9357df2ae1755cc62a0a014 + md5: a6993977a14feee4268e7be3ad0977ab + depends: + - __glibc >=2.17,<3.0.a0 + - krb5 >=1.22.2,<1.23.0a0 + - libcurl 8.19.0 hcf29cc6_0 + - libgcc >=14 + - libssh2 >=1.11.1,<2.0a0 + - libzlib >=1.3.1,<2.0a0 + - openssl >=3.5.5,<4.0a0 + - zstd >=1.5.7,<1.6.0a0 + license: curl + license_family: MIT + size: 191335 + timestamp: 1773218536473 +- conda: https://conda.anaconda.org/conda-forge/linux-64/debugpy-1.8.20-py313h5d5ffb9_0.conda + sha256: 8d76d4eeb5a8e3c5666880b465593fdf4a44f47fbbe89ff5b8f9abbe43026326 + md5: e94dbbec2589f3b1d821f43a4bf2ab45 + depends: + - python + - libstdcxx >=14 + - libgcc >=14 + - __glibc >=2.17,<3.0.a0 + - python_abi 3.13.* *_cp313 + license: MIT + license_family: MIT + size: 2872698 + timestamp: 1769744980407 - conda: https://conda.anaconda.org/conda-forge/noarch/decorator-5.2.1-pyhd8ed1ab_0.conda sha256: c17c6b9937c08ad63cb20a26f403a3234088e57d4455600974a0ce865cb14017 md5: 9ce473d1d1be1cc3810856a48b3fab32 @@ -151,6 +751,24 @@ packages: license_family: BSD size: 14129 timestamp: 1740385067843 +- conda: https://conda.anaconda.org/conda-forge/noarch/defusedxml-0.7.1-pyhd8ed1ab_0.tar.bz2 + sha256: 9717a059677553562a8f38ff07f3b9f61727bd614f505658b0a5ecbcf8df89be + md5: 961b3a227b437d82ad7054484cfa71b2 + depends: + - python >=3.6 + license: PSF-2.0 + license_family: PSF + size: 24062 + timestamp: 1615232388757 +- conda: https://conda.anaconda.org/conda-forge/noarch/exceptiongroup-1.3.1-pyhd8ed1ab_0.conda + sha256: ee6cf346d017d954255bbcbdb424cddea4d14e4ed7e9813e429db1d795d01144 + md5: 8e662bd460bda79b1ea39194e3c4c9ab + depends: + - python >=3.10 + - typing_extensions >=4.6.0 + license: MIT and PSF-2.0 + size: 21333 + timestamp: 1763918099466 - conda: https://conda.anaconda.org/conda-forge/noarch/executing-2.2.1-pyhd8ed1ab_0.conda sha256: 210c8165a58fdbf16e626aac93cc4c14dbd551a01d1516be5ecad795d2422cad md5: ff9efb7f7469aed3c4a8106ffa29593c @@ -160,6 +778,239 @@ packages: license_family: MIT size: 30753 timestamp: 1756729456476 +- conda: https://conda.anaconda.org/conda-forge/noarch/font-ttf-dejavu-sans-mono-2.37-hab24e00_0.tar.bz2 + sha256: 58d7f40d2940dd0a8aa28651239adbf5613254df0f75789919c4e6762054403b + md5: 0c96522c6bdaed4b1566d11387caaf45 + license: BSD-3-Clause + license_family: BSD + size: 397370 + timestamp: 1566932522327 +- conda: https://conda.anaconda.org/conda-forge/noarch/font-ttf-inconsolata-3.000-h77eed37_0.tar.bz2 + sha256: c52a29fdac682c20d252facc50f01e7c2e7ceac52aa9817aaf0bb83f7559ec5c + md5: 34893075a5c9e55cdafac56607368fc6 + license: OFL-1.1 + license_family: Other + size: 96530 + timestamp: 1620479909603 +- conda: https://conda.anaconda.org/conda-forge/noarch/font-ttf-source-code-pro-2.038-h77eed37_0.tar.bz2 + sha256: 00925c8c055a2275614b4d983e1df637245e19058d79fc7dd1a93b8d9fb4b139 + md5: 4d59c254e01d9cde7957100457e2d5fb + license: OFL-1.1 + license_family: Other + size: 700814 + timestamp: 1620479612257 +- conda: https://conda.anaconda.org/conda-forge/noarch/font-ttf-ubuntu-0.83-h77eed37_3.conda + sha256: 2821ec1dc454bd8b9a31d0ed22a7ce22422c0aef163c59f49dfdf915d0f0ca14 + md5: 49023d73832ef61042f6a237cb2687e7 + license: LicenseRef-Ubuntu-Font-Licence-Version-1.0 + license_family: Other + size: 1620504 + timestamp: 1727511233259 +- conda: https://conda.anaconda.org/conda-forge/linux-64/fontconfig-2.17.1-h27c8c51_0.conda + sha256: aa4a44dba97151221100a637c7f4bde619567afade9c0265f8e1c8eed8d7bd8c + md5: 867127763fbe935bab59815b6e0b7b5c + depends: + - __glibc >=2.17,<3.0.a0 + - libexpat >=2.7.4,<3.0a0 + - libfreetype >=2.14.1 + - libfreetype6 >=2.14.1 + - libgcc >=14 + - libuuid >=2.41.3,<3.0a0 + - libzlib >=1.3.1,<2.0a0 + license: MIT + license_family: MIT + size: 270705 + timestamp: 1771382710863 +- conda: https://conda.anaconda.org/conda-forge/noarch/fonts-conda-ecosystem-1-0.tar.bz2 + sha256: a997f2f1921bb9c9d76e6fa2f6b408b7fa549edd349a77639c9fe7a23ea93e61 + md5: fee5683a3f04bd15cbd8318b096a27ab + depends: + - fonts-conda-forge + license: BSD-3-Clause + license_family: BSD + size: 3667 + timestamp: 1566974674465 +- conda: https://conda.anaconda.org/conda-forge/noarch/fonts-conda-forge-1-hc364b38_1.conda + sha256: 54eea8469786bc2291cc40bca5f46438d3e062a399e8f53f013b6a9f50e98333 + md5: a7970cd949a077b7cb9696379d338681 + depends: + - font-ttf-ubuntu + - font-ttf-inconsolata + - font-ttf-dejavu-sans-mono + - font-ttf-source-code-pro + license: BSD-3-Clause + license_family: BSD + size: 4059 + timestamp: 1762351264405 +- conda: https://conda.anaconda.org/conda-forge/noarch/fqdn-1.5.1-pyhd8ed1ab_1.conda + sha256: 2509992ec2fd38ab27c7cdb42cf6cadc566a1cc0d1021a2673475d9fa87c6276 + md5: d3549fd50d450b6d9e7dddff25dd2110 + depends: + - cached-property >=1.3.0 + - python >=3.9,<4 + license: MPL-2.0 + license_family: MOZILLA + size: 16705 + timestamp: 1733327494780 +- conda: https://conda.anaconda.org/conda-forge/linux-64/fribidi-1.0.16-hb03c661_0.conda + sha256: 858283ff33d4c033f4971bf440cebff217d5552a5222ba994c49be990dacd40d + md5: f9f81ea472684d75b9dd8d0b328cf655 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + license: LGPL-2.1-or-later + size: 61244 + timestamp: 1757438574066 +- conda: https://conda.anaconda.org/conda-forge/linux-64/gcc_impl_linux-64-15.2.0-he420e7e_18.conda + sha256: a088cfd3ae6fa83815faa8703bc9d21cc915f17bd1b51aac9c16ddf678da21e4 + md5: cf56b6d74f580b91fd527e10d9a2e324 + depends: + - binutils_impl_linux-64 >=2.45 + - libgcc >=15.2.0 + - libgcc-devel_linux-64 15.2.0 hcc6f6b0_118 + - libgomp >=15.2.0 + - libsanitizer 15.2.0 h90f66d4_18 + - libstdcxx >=15.2.0 + - libstdcxx-devel_linux-64 15.2.0 hd446a21_118 + - sysroot_linux-64 + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 81814135 + timestamp: 1771378369317 +- conda: https://conda.anaconda.org/conda-forge/linux-64/gfortran_impl_linux-64-15.2.0-h281d09f_18.conda + sha256: 737c191cc768822d3d2ace8650e0cbec5edc4b48c63024876d0e6b0b5f120be2 + md5: d19ccc223bcd1d4e3f6b5884b7b58add + depends: + - gcc_impl_linux-64 >=15.2.0 + - libgcc >=15.2.0 + - libgfortran5 >=15.2.0 + - libstdcxx >=15.2.0 + - sysroot_linux-64 + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 20044877 + timestamp: 1771378561135 +- conda: https://conda.anaconda.org/conda-forge/linux-64/graphite2-1.3.14-hecca717_2.conda + sha256: 25ba37da5c39697a77fce2c9a15e48cf0a84f1464ad2aafbe53d8357a9f6cc8c + md5: 2cd94587f3a401ae05e03a6caf09539d + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + license: LGPL-2.0-or-later + license_family: LGPL + size: 99596 + timestamp: 1755102025473 +- conda: https://conda.anaconda.org/conda-forge/linux-64/gsl-2.7-he838d99_0.tar.bz2 + sha256: 132a918b676dd1f533d7c6f95e567abf7081a6ea3251c3280de35ef600e0da87 + md5: fec079ba39c9cca093bf4c00001825de + depends: + - libblas >=3.8.0,<4.0a0 + - libcblas >=3.8.0,<4.0a0 + - libgcc-ng >=9.3.0 + license: GPL-3.0-or-later + license_family: GPL + size: 3376423 + timestamp: 1626369596591 +- conda: https://conda.anaconda.org/conda-forge/linux-64/gxx_impl_linux-64-15.2.0-hda75c37_18.conda + sha256: 48946f1f43d699b68123fb39329ef5acf3d9cbf8f96bdb8fb14b6197f5402825 + md5: e39123ab71f2e4cf989aa6aa5fafdaaf + depends: + - gcc_impl_linux-64 15.2.0 he420e7e_18 + - libstdcxx-devel_linux-64 15.2.0 hd446a21_118 + - sysroot_linux-64 + - tzdata + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 15587873 + timestamp: 1771378609722 +- conda: https://conda.anaconda.org/conda-forge/noarch/h11-0.16.0-pyhcf101f3_1.conda + sha256: 96cac6573fd35ae151f4d6979bab6fbc90cb6b1fb99054ba19eb075da9822fcb + md5: b8993c19b0c32a2f7b66cbb58ca27069 + depends: + - python >=3.10 + - typing_extensions + - python + license: MIT + license_family: MIT + size: 39069 + timestamp: 1767729720872 +- conda: https://conda.anaconda.org/conda-forge/noarch/h2-4.3.0-pyhcf101f3_0.conda + sha256: 84c64443368f84b600bfecc529a1194a3b14c3656ee2e832d15a20e0329b6da3 + md5: 164fc43f0b53b6e3a7bc7dce5e4f1dc9 + depends: + - python >=3.10 + - hyperframe >=6.1,<7 + - hpack >=4.1,<5 + - python + license: MIT + license_family: MIT + size: 95967 + timestamp: 1756364871835 +- conda: https://conda.anaconda.org/conda-forge/linux-64/harfbuzz-14.2.0-h6083320_0.conda + sha256: 232c95b56d16d33d8256026a3b1ad34f7f9a75c179d388854be0fd624ddba9e3 + md5: e194f6a2f498f0c7b1e6498bd0b12645 + depends: + - __glibc >=2.17,<3.0.a0 + - cairo >=1.18.4,<2.0a0 + - graphite2 >=1.3.14,<2.0a0 + - icu >=78.3,<79.0a0 + - libexpat >=2.7.5,<3.0a0 + - libfreetype >=2.14.3 + - libfreetype6 >=2.14.3 + - libgcc >=14 + - libglib >=2.86.4,<3.0a0 + - libstdcxx >=14 + - libzlib >=1.3.2,<2.0a0 + license: MIT + size: 2333599 + timestamp: 1776778392713 +- conda: https://conda.anaconda.org/conda-forge/noarch/hpack-4.1.0-pyhd8ed1ab_0.conda + sha256: 6ad78a180576c706aabeb5b4c8ceb97c0cb25f1e112d76495bff23e3779948ba + md5: 0a802cb9888dd14eeefc611f05c40b6e + depends: + - python >=3.9 + license: MIT + license_family: MIT + size: 30731 + timestamp: 1737618390337 +- conda: https://conda.anaconda.org/conda-forge/noarch/httpcore-1.0.9-pyh29332c3_0.conda + sha256: 04d49cb3c42714ce533a8553986e1642d0549a05dc5cc48e0d43ff5be6679a5b + md5: 4f14640d58e2cc0aa0819d9d8ba125bb + depends: + - python >=3.9 + - h11 >=0.16 + - h2 >=3,<5 + - sniffio 1.* + - anyio >=4.0,<5.0 + - certifi + - python + license: BSD-3-Clause + license_family: BSD + size: 49483 + timestamp: 1745602916758 +- conda: https://conda.anaconda.org/conda-forge/noarch/httpx-0.28.1-pyhd8ed1ab_0.conda + sha256: cd0f1de3697b252df95f98383e9edb1d00386bfdd03fdf607fa42fe5fcb09950 + md5: d6989ead454181f4f9bc987d3dc4e285 + depends: + - anyio + - certifi + - httpcore 1.* + - idna + - python >=3.9 + license: BSD-3-Clause + license_family: BSD + size: 63082 + timestamp: 1733663449209 +- conda: https://conda.anaconda.org/conda-forge/noarch/hyperframe-6.1.0-pyhd8ed1ab_0.conda + sha256: 77af6f5fe8b62ca07d09ac60127a30d9069fdc3c68d6b256754d0ffb1f7779f8 + md5: 8e6923fc12f1fe8f8c4e5c9f343256ac + depends: + - python >=3.9 + license: MIT + license_family: MIT + size: 17397 + timestamp: 1737618427549 - conda: https://conda.anaconda.org/conda-forge/linux-64/icu-78.3-h33c6efd_0.conda sha256: fbf86c4a59c2ed05bbffb2ba25c7ed94f6185ec30ecb691615d42342baa1a16a md5: c80d8a3b84358cb967fa81e7075fbc8a @@ -171,6 +1022,15 @@ packages: license_family: MIT size: 12723451 timestamp: 1773822285671 +- conda: https://conda.anaconda.org/conda-forge/noarch/idna-3.13-pyhcf101f3_0.conda + sha256: 9ab620e6f64bb67737bd7bc1ad6f480770124e304c6710617aba7fe60b089f48 + md5: fb7130c190f9b4ec91219840a05ba3ac + depends: + - python >=3.10 + - python + license: BSD-3-Clause + size: 59038 + timestamp: 1776947141407 - conda: https://conda.anaconda.org/conda-forge/noarch/importlib-metadata-8.8.0-pyhcf101f3_0.conda sha256: 82ab2a0d91ca1e7e63ab6a4939356667ef683905dea631bc2121aa534d347b16 md5: 080594bf4493e6bae2607e65390c520a @@ -182,6 +1042,43 @@ packages: license_family: APACHE size: 34387 timestamp: 1773931568510 +- conda: https://conda.anaconda.org/conda-forge/noarch/importlib_resources-7.1.0-pyhd8ed1ab_0.conda + sha256: a563a51aa522998172838e867e6dedcf630bc45796e8612f5a1f6d73e9c8125a + md5: 0ba6225c279baf7ea9473a62ea0ec9ae + depends: + - python >=3.10 + - zipp >=3.1.0 + constrains: + - importlib-resources >=7.1.0,<7.1.1.0a0 + license: Apache-2.0 + license_family: APACHE + size: 34809 + timestamp: 1776068839274 +- conda: https://conda.anaconda.org/conda-forge/noarch/ipykernel-7.2.0-pyha191276_1.conda + sha256: b77ed58eb235e5ad80e742b03caeed4bbc2a2ef064cb9a2deee3b75dfae91b2a + md5: 8b267f517b81c13594ed68d646fd5dcb + depends: + - __linux + - comm >=0.1.1 + - debugpy >=1.6.5 + - ipython >=7.23.1 + - jupyter_client >=8.8.0 + - jupyter_core >=5.1,!=6.0.* + - matplotlib-inline >=0.1 + - nest-asyncio >=1.4 + - packaging >=22 + - psutil >=5.7 + - python >=3.10 + - pyzmq >=25 + - tornado >=6.4.1 + - traitlets >=5.4.0 + - python + constrains: + - appnope >=0.1.2 + license: BSD-3-Clause + license_family: BSD + size: 133644 + timestamp: 1770566133040 - conda: https://conda.anaconda.org/conda-forge/noarch/ipython-9.12.0-pyhecfbec7_0.conda sha256: 932044bd893f7adce6c9b384b96a72fd3804cc381e76789398c2fae900f21df7 md5: b293210beb192c3024683bf6a998a0b8 @@ -212,6 +1109,30 @@ packages: license_family: BSD size: 13993 timestamp: 1737123723464 +- conda: https://conda.anaconda.org/conda-forge/noarch/ipywidgets-8.1.8-pyhd8ed1ab_0.conda + sha256: 6bb58afb7eabc8b4ac0c7e92707fb498313cc0164cf04e7ba1090dbf49af514b + md5: d68e3f70d1f068f1b66d94822fdc644e + depends: + - comm >=0.1.3 + - ipython >=6.1.0 + - jupyterlab_widgets >=3.0.15,<3.1.0 + - python >=3.10 + - traitlets >=4.3.1 + - widgetsnbextension >=4.0.14,<4.1.0 + license: BSD-3-Clause + license_family: BSD + size: 114376 + timestamp: 1762040524661 +- conda: https://conda.anaconda.org/conda-forge/noarch/isoduration-20.11.0-pyhd8ed1ab_1.conda + sha256: 08e838d29c134a7684bca0468401d26840f41c92267c4126d7b43a6b533b0aed + md5: 0b0154421989637d424ccf0f104be51a + depends: + - arrow >=0.15.0 + - python >=3.9 + license: MIT + license_family: MIT + size: 19832 + timestamp: 1733493720346 - conda: https://conda.anaconda.org/conda-forge/noarch/jedi-0.19.2-pyhd8ed1ab_1.conda sha256: 92c4d217e2dc68983f724aa983cca5464dcb929c566627b26a2511159667dba8 md5: a4f4c5dc9b80bc50e0d3dc4e6e8f1bd9 @@ -221,33 +1142,432 @@ packages: license: Apache-2.0 AND MIT size: 843646 timestamp: 1733300981994 -- conda: https://conda.anaconda.org/conda-forge/linux-64/ld_impl_linux-64-2.45.1-default_hbd61a6d_102.conda - sha256: 3d584956604909ff5df353767f3a2a2f60e07d070b328d109f30ac40cd62df6c - md5: 18335a698559cdbcd86150a48bf54ba6 +- conda: https://conda.anaconda.org/conda-forge/noarch/jinja2-3.1.6-pyhcf101f3_1.conda + sha256: fc9ca7348a4f25fed2079f2153ecdcf5f9cf2a0bc36c4172420ca09e1849df7b + md5: 04558c96691bed63104678757beb4f8d depends: - - __glibc >=2.17,<3.0.a0 - - zstd >=1.5.7,<1.6.0a0 - constrains: - - binutils_impl_linux-64 2.45.1 - license: GPL-3.0-only - license_family: GPL - size: 728002 - timestamp: 1774197446916 -- conda: https://conda.anaconda.org/conda-forge/linux-64/libexpat-2.7.5-hecca717_0.conda - sha256: e8c2b57f6aacabdf2f1b0924bd4831ce5071ba080baa4a9e8c0d720588b6794c - md5: 49f570f3bc4c874a06ea69b7225753af + - markupsafe >=2.0 + - python >=3.10 + - python + license: BSD-3-Clause + license_family: BSD + size: 120685 + timestamp: 1764517220861 +- conda: https://conda.anaconda.org/conda-forge/noarch/json5-0.14.0-pyhd8ed1ab_0.conda + sha256: 9daa95bd164c8fa23b3ab196e906ef806141d749eddce2a08baa064f722d25fa + md5: 1269891272187518a0a75c286f7d0bbf depends: - - __glibc >=2.17,<3.0.a0 - - libgcc >=14 - constrains: - - expat 2.7.5.* - license: MIT - license_family: MIT - size: 76624 - timestamp: 1774719175983 -- conda: https://conda.anaconda.org/conda-forge/linux-64/libffi-3.5.2-h3435931_0.conda - sha256: 31f19b6a88ce40ebc0d5a992c131f57d919f73c0b92cd1617a5bec83f6e961e6 - md5: a360c33a5abe61c07959e449fa1453eb + - python >=3.10 + license: Apache-2.0 + license_family: APACHE + size: 34731 + timestamp: 1774655440045 +- conda: https://conda.anaconda.org/conda-forge/noarch/jsonpointer-3.1.1-pyhcf101f3_0.conda + sha256: a3d10301b6ff399ba1f3d39e443664804a3d28315a4fb81e745b6817845f70ae + md5: 89bf346df77603055d3c8fe5811691e6 + depends: + - python >=3.10 + - python + license: BSD-3-Clause + license_family: BSD + size: 14190 + timestamp: 1774311356147 +- conda: https://conda.anaconda.org/conda-forge/noarch/jsonschema-4.26.0-pyhcf101f3_0.conda + sha256: db973a37d75db8e19b5f44bbbdaead0c68dde745407f281e2a7fe4db74ec51d7 + md5: ada41c863af263cc4c5fcbaff7c3e4dc + depends: + - attrs >=22.2.0 + - jsonschema-specifications >=2023.3.6 + - python >=3.10 + - referencing >=0.28.4 + - rpds-py >=0.25.0 + - python + license: MIT + license_family: MIT + size: 82356 + timestamp: 1767839954256 +- conda: https://conda.anaconda.org/conda-forge/noarch/jsonschema-specifications-2025.9.1-pyhcf101f3_0.conda + sha256: 0a4f3b132f0faca10c89fdf3b60e15abb62ded6fa80aebfc007d05965192aa04 + md5: 439cd0f567d697b20a8f45cb70a1005a + depends: + - python >=3.10 + - referencing >=0.31.0 + - python + license: MIT + license_family: MIT + size: 19236 + timestamp: 1757335715225 +- conda: https://conda.anaconda.org/conda-forge/noarch/jsonschema-with-format-nongpl-4.26.0-hcf101f3_0.conda + sha256: 6886fc61e4e4edd38fd38729976b134e8bd2143f7fce56cc80d7ac7bac99bce1 + md5: 8368d58342d0825f0843dc6acdd0c483 + depends: + - jsonschema >=4.26.0,<4.26.1.0a0 + - fqdn + - idna + - isoduration + - jsonpointer >1.13 + - rfc3339-validator + - rfc3986-validator >0.1.0 + - rfc3987-syntax >=1.1.0 + - uri-template + - webcolors >=24.6.0 + license: MIT + license_family: MIT + size: 4740 + timestamp: 1767839954258 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyter-1.1.1-pyhd8ed1ab_1.conda + sha256: b538e15067d05768d1c0532a6d9b0625922a1cce751dd6a2af04f7233a1a70e9 + md5: 9453512288d20847de4356327d0e1282 + depends: + - ipykernel + - ipywidgets + - jupyter_console + - jupyterlab + - nbconvert-core + - notebook + - python >=3.9 + license: BSD-3-Clause + license_family: BSD + size: 8891 + timestamp: 1733818677113 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyter-lsp-2.3.1-pyhcf101f3_0.conda + sha256: 3766e2ae59641c172cec8a821528bfa6bf9543ffaaeb8b358bfd5259dcf18e4e + md5: 0c3b465ceee138b9c39279cc02e5c4a0 + depends: + - importlib-metadata >=4.8.3 + - jupyter_server >=1.1.2 + - python >=3.10 + - python + license: BSD-3-Clause + license_family: BSD + size: 61633 + timestamp: 1775136333147 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_client-8.8.0-pyhcf101f3_0.conda + sha256: e402bd119720862a33229624ec23645916a7d47f30e1711a4af9e005162b84f3 + md5: 8a3d6d0523f66cf004e563a50d9392b3 + depends: + - jupyter_core >=5.1 + - python >=3.10 + - python-dateutil >=2.8.2 + - pyzmq >=25.0 + - tornado >=6.4.1 + - traitlets >=5.3 + - python + license: BSD-3-Clause + license_family: BSD + size: 112785 + timestamp: 1767954655912 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_console-6.6.3-pyhd8ed1ab_1.conda + sha256: aee0cdd0cb2b9321d28450aec4e0fd43566efcd79e862d70ce49a68bf0539bcd + md5: 801dbf535ec26508fac6d4b24adfb76e + depends: + - ipykernel >=6.14 + - ipython + - jupyter_client >=7.0.0 + - jupyter_core >=4.12,!=5.0.* + - prompt_toolkit >=3.0.30 + - pygments + - python >=3.9 + - pyzmq >=17 + - traitlets >=5.4 + license: BSD-3-Clause + license_family: BSD + size: 26874 + timestamp: 1733818130068 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_core-5.9.1-pyhc90fa1f_0.conda + sha256: 1d34b80e5bfcd5323f104dbf99a2aafc0e5d823019d626d0dce5d3d356a2a52a + md5: b38fe4e78ee75def7e599843ef4c1ab0 + depends: + - __unix + - python + - platformdirs >=2.5 + - python >=3.10 + - traitlets >=5.3 + - python + constrains: + - pywin32 >=300 + license: BSD-3-Clause + license_family: BSD + size: 65503 + timestamp: 1760643864586 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_events-0.12.1-pyhcf101f3_0.conda + sha256: c7edb5682c6316a95ad781dccb1b6589cd2ec0bf94f23c21152974eb0363b5d7 + md5: bf42ee94c750c0b2e7e998b79ac299ea + depends: + - jsonschema-with-format-nongpl >=4.18.0 + - packaging + - python >=3.10 + - python-json-logger >=2.0.4 + - pyyaml >=5.3 + - referencing + - rfc3339-validator + - rfc3986-validator >=0.1.1 + - traitlets >=5.3 + - python + license: BSD-3-Clause + size: 24002 + timestamp: 1776861872237 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_server-2.17.0-pyhcf101f3_0.conda + sha256: 74c4e642be97c538dae1895f7052599dfd740d8bd251f727bce6453ce8d6cd9a + md5: d79a87dcfa726bcea8e61275feed6f83 + depends: + - anyio >=3.1.0 + - argon2-cffi >=21.1 + - jinja2 >=3.0.3 + - jupyter_client >=7.4.4 + - jupyter_core >=4.12,!=5.0.* + - jupyter_events >=0.11.0 + - jupyter_server_terminals >=0.4.4 + - nbconvert-core >=6.4.4 + - nbformat >=5.3.0 + - overrides >=5.0 + - packaging >=22.0 + - prometheus_client >=0.9 + - python >=3.10 + - pyzmq >=24 + - send2trash >=1.8.2 + - terminado >=0.8.3 + - tornado >=6.2.0 + - traitlets >=5.6.0 + - websocket-client >=1.7 + - python + license: BSD-3-Clause + license_family: BSD + size: 347094 + timestamp: 1755870522134 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyter_server_terminals-0.5.4-pyhcf101f3_0.conda + sha256: 5eda79ed9f53f590031d29346abd183051263227dd9ee667b5ca1133ce297654 + md5: 7b8bace4943e0dc345fc45938826f2b8 + depends: + - python >=3.10 + - terminado >=0.8.3 + - python + license: BSD-3-Clause + license_family: BSD + size: 22052 + timestamp: 1768574057200 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyterlab-4.5.6-pyhd8ed1ab_0.conda + sha256: 436a70259a9b4e13ce8b15faa8b37342835954d77a0a74d21dd24547e0871088 + md5: bcbb401d6fa84e0cee34d4926b0e9e93 + depends: + - async-lru >=1.0.0 + - httpx >=0.25.0,<1 + - ipykernel >=6.5.0,!=6.30.0 + - jinja2 >=3.0.3 + - jupyter-lsp >=2.0.0 + - jupyter_core + - jupyter_server >=2.4.0,<3 + - jupyterlab_server >=2.28.0,<3 + - notebook-shim >=0.2 + - packaging + - python >=3.10 + - setuptools >=41.1.0 + - tomli >=1.2.2 + - tornado >=6.2.0 + - traitlets + license: BSD-3-Clause + license_family: BSD + size: 8245973 + timestamp: 1773240966438 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyterlab_pygments-0.3.0-pyhd8ed1ab_2.conda + sha256: dc24b900742fdaf1e077d9a3458fd865711de80bca95fe3c6d46610c532c6ef0 + md5: fd312693df06da3578383232528c468d + depends: + - pygments >=2.4.1,<3 + - python >=3.9 + constrains: + - jupyterlab >=4.0.8,<5.0.0 + license: BSD-3-Clause + license_family: BSD + size: 18711 + timestamp: 1733328194037 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyterlab_server-2.28.0-pyhcf101f3_0.conda + sha256: 381d2d6a259a3be5f38a69463e0f6c5dcf1844ae113058007b51c3bef13a7cee + md5: a63877cb23de826b1620d3adfccc4014 + depends: + - babel >=2.10 + - jinja2 >=3.0.3 + - json5 >=0.9.0 + - jsonschema >=4.18 + - jupyter_server >=1.21,<3 + - packaging >=21.3 + - python >=3.10 + - requests >=2.31 + - python + license: BSD-3-Clause + license_family: BSD + size: 51621 + timestamp: 1761145478692 +- conda: https://conda.anaconda.org/conda-forge/noarch/jupyterlab_widgets-3.0.16-pyhcf101f3_1.conda + sha256: 5c03de243d7ae6247f39a402f4785d95e61c3be79ef18738e8f17155585d31a8 + md5: dbf8b81974504fa51d34e436ca7ef389 + depends: + - python >=3.10 + - python + constrains: + - jupyterlab >=3,<5 + license: BSD-3-Clause + license_family: BSD + size: 216779 + timestamp: 1762267481404 +- conda: https://conda.anaconda.org/conda-forge/noarch/kernel-headers_linux-64-4.18.0-he073ed8_9.conda + sha256: 41557eeadf641de6aeae49486cef30d02a6912d8da98585d687894afd65b356a + md5: 86d9cba083cd041bfbf242a01a7a1999 + constrains: + - sysroot_linux-64 ==2.28 + license: LGPL-2.0-or-later AND LGPL-2.0-or-later WITH exceptions AND GPL-2.0-or-later + license_family: GPL + size: 1278712 + timestamp: 1765578681495 +- conda: https://conda.anaconda.org/conda-forge/linux-64/keyutils-1.6.3-hb9d3cd8_0.conda + sha256: 0960d06048a7185d3542d850986d807c6e37ca2e644342dd0c72feefcf26c2a4 + md5: b38117a3c920364aff79f870c984b4a3 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + license: LGPL-2.1-or-later + size: 134088 + timestamp: 1754905959823 +- conda: https://conda.anaconda.org/conda-forge/linux-64/krb5-1.22.2-ha1258a1_0.conda + sha256: 3e307628ca3527448dd1cb14ad7bb9d04d1d28c7d4c5f97ba196ae984571dd25 + md5: fb53fb07ce46a575c5d004bbc96032c2 + depends: + - __glibc >=2.17,<3.0.a0 + - keyutils >=1.6.3,<2.0a0 + - libedit >=3.1.20250104,<3.2.0a0 + - libedit >=3.1.20250104,<4.0a0 + - libgcc >=14 + - libstdcxx >=14 + - openssl >=3.5.5,<4.0a0 + license: MIT + license_family: MIT + size: 1386730 + timestamp: 1769769569681 +- conda: https://conda.anaconda.org/conda-forge/noarch/lark-1.3.1-pyhd8ed1ab_0.conda + sha256: 49570840fb15f5df5d4b4464db8ee43a6d643031a2bc70ef52120a52e3809699 + md5: 9b965c999135d43a3d0f7bd7d024e26a + depends: + - python >=3.10 + license: MIT + license_family: MIT + size: 94312 + timestamp: 1761596921009 +- conda: https://conda.anaconda.org/conda-forge/linux-64/ld_impl_linux-64-2.45.1-default_hbd61a6d_102.conda + sha256: 3d584956604909ff5df353767f3a2a2f60e07d070b328d109f30ac40cd62df6c + md5: 18335a698559cdbcd86150a48bf54ba6 + depends: + - __glibc >=2.17,<3.0.a0 + - zstd >=1.5.7,<1.6.0a0 + constrains: + - binutils_impl_linux-64 2.45.1 + license: GPL-3.0-only + license_family: GPL + size: 728002 + timestamp: 1774197446916 +- conda: https://conda.anaconda.org/conda-forge/linux-64/lerc-4.1.0-hdb68285_0.conda + sha256: f84cb54782f7e9cea95e810ea8fef186e0652d0fa73d3009914fa2c1262594e1 + md5: a752488c68f2e7c456bcbd8f16eec275 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + license: Apache-2.0 + license_family: Apache + size: 261513 + timestamp: 1773113328888 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libblas-3.11.0-6_h4a7cf45_openblas.conda + build_number: 6 + sha256: 7bfe936dbb5db04820cf300a9cc1f5ee8d5302fc896c2d66e30f1ee2f20fbfd6 + md5: 6d6d225559bfa6e2f3c90ee9c03d4e2e + depends: + - libopenblas >=0.3.32,<0.3.33.0a0 + - libopenblas >=0.3.32,<1.0a0 + constrains: + - blas 2.306 openblas + - liblapack 3.11.0 6*_openblas + - liblapacke 3.11.0 6*_openblas + - libcblas 3.11.0 6*_openblas + - mkl <2026 + license: BSD-3-Clause + license_family: BSD + size: 18621 + timestamp: 1774503034895 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libcblas-3.11.0-6_h0358290_openblas.conda + build_number: 6 + sha256: 57edafa7796f6fa3ebbd5367692dd4c7f552be42109c2dd1a7c89b55089bf374 + md5: 36ae340a916635b97ac8a0655ace2a35 + depends: + - libblas 3.11.0 6_h4a7cf45_openblas + constrains: + - blas 2.306 openblas + - liblapack 3.11.0 6*_openblas + - liblapacke 3.11.0 6*_openblas + license: BSD-3-Clause + license_family: BSD + size: 18622 + timestamp: 1774503050205 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libcurl-8.19.0-hcf29cc6_0.conda + sha256: a0390fd0536ebcd2244e243f5f00ab8e76ab62ed9aa214cd54470fe7496620f4 + md5: d50608c443a30c341c24277d28290f76 + depends: + - __glibc >=2.17,<3.0.a0 + - krb5 >=1.22.2,<1.23.0a0 + - libgcc >=14 + - libnghttp2 >=1.67.0,<2.0a0 + - libssh2 >=1.11.1,<2.0a0 + - libzlib >=1.3.1,<2.0a0 + - openssl >=3.5.5,<4.0a0 + - zstd >=1.5.7,<1.6.0a0 + license: curl + license_family: MIT + size: 466704 + timestamp: 1773218522665 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libdeflate-1.25-h17f619e_0.conda + sha256: aa8e8c4be9a2e81610ddf574e05b64ee131fab5e0e3693210c9d6d2fba32c680 + md5: 6c77a605a7a689d17d4819c0f8ac9a00 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + license: MIT + license_family: MIT + size: 73490 + timestamp: 1761979956660 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libedit-3.1.20250104-pl5321h7949ede_0.conda + sha256: d789471216e7aba3c184cd054ed61ce3f6dac6f87a50ec69291b9297f8c18724 + md5: c277e0a4d549b03ac1e9d6cbbe3d017b + depends: + - ncurses + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + - ncurses >=6.5,<7.0a0 + license: BSD-2-Clause + license_family: BSD + size: 134676 + timestamp: 1738479519902 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libev-4.33-hd590300_2.conda + sha256: 1cd6048169fa0395af74ed5d8f1716e22c19a81a8a36f934c110ca3ad4dd27b4 + md5: 172bf1cd1ff8629f2b1179945ed45055 + depends: + - libgcc-ng >=12 + license: BSD-2-Clause + license_family: BSD + size: 112766 + timestamp: 1702146165126 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libexpat-2.7.5-hecca717_0.conda + sha256: e8c2b57f6aacabdf2f1b0924bd4831ce5071ba080baa4a9e8c0d720588b6794c + md5: 49f570f3bc4c874a06ea69b7225753af + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + constrains: + - expat 2.7.5.* + license: MIT + license_family: MIT + size: 76624 + timestamp: 1774719175983 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libffi-3.5.2-h3435931_0.conda + sha256: 31f19b6a88ce40ebc0d5a992c131f57d919f73c0b92cd1617a5bec83f6e961e6 + md5: a360c33a5abe61c07959e449fa1453eb depends: - __glibc >=2.17,<3.0.a0 - libgcc >=14 @@ -255,6 +1575,27 @@ packages: license_family: MIT size: 58592 timestamp: 1769456073053 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libfreetype-2.14.3-ha770c72_0.conda + sha256: 38f014a7129e644636e46064ecd6b1945e729c2140e21d75bb476af39e692db2 + md5: e289f3d17880e44b633ba911d57a321b + depends: + - libfreetype6 >=2.14.3 + license: GPL-2.0-only OR FTL + size: 8049 + timestamp: 1774298163029 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libfreetype6-2.14.3-h73754d4_0.conda + sha256: 16f020f96da79db1863fcdd8f2b8f4f7d52f177dd4c58601e38e9182e91adf1d + md5: fb16b4b69e3f1dcfe79d80db8fd0c55d + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libpng >=1.6.55,<1.7.0a0 + - libzlib >=1.3.2,<2.0a0 + constrains: + - freetype >=2.14.3 + license: GPL-2.0-only OR FTL + size: 384575 + timestamp: 1774298162622 - conda: https://conda.anaconda.org/conda-forge/linux-64/libgcc-15.2.0-he0feb66_18.conda sha256: faf7d2017b4d718951e3a59d081eb09759152f93038479b768e3d612688f83f5 md5: 0aa00f03f9e39fb9876085dee11a85d4 @@ -268,6 +1609,71 @@ packages: license_family: GPL size: 1041788 timestamp: 1771378212382 +- conda: https://conda.anaconda.org/conda-forge/noarch/libgcc-devel_linux-64-15.2.0-hcc6f6b0_118.conda + sha256: af69fc5852908d26e5b630b270982ac792506551dd6af1614bf0370dd5ab5746 + md5: 5d3a96d55f1be45fef88ee23155effd9 + depends: + - __unix + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 3085932 + timestamp: 1771378098166 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libgcc-ng-15.2.0-h69a702a_18.conda + sha256: e318a711400f536c81123e753d4c797a821021fb38970cebfb3f454126016893 + md5: d5e96b1ed75ca01906b3d2469b4ce493 + depends: + - libgcc 15.2.0 he0feb66_18 + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 27526 + timestamp: 1771378224552 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libgfortran-15.2.0-h69a702a_18.conda + sha256: d2c9fad338fd85e4487424865da8e74006ab2e2475bd788f624d7a39b2a72aee + md5: 9063115da5bc35fdc3e1002e69b9ef6e + depends: + - libgfortran5 15.2.0 h68bc16d_18 + constrains: + - libgfortran-ng ==15.2.0=*_18 + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 27523 + timestamp: 1771378269450 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libgfortran-ng-15.2.0-h69a702a_18.conda + sha256: cdc147bb0966be39b697b28d40b1ab5a2cd57fb29aff0fb0406598d419bddd70 + md5: 26d7b228de99d6fb032ba4d5c1679040 + depends: + - libgfortran 15.2.0 h69a702a_18 + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 27532 + timestamp: 1771378479717 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libgfortran5-15.2.0-h68bc16d_18.conda + sha256: 539b57cf50ec85509a94ba9949b7e30717839e4d694bc94f30d41c9d34de2d12 + md5: 646855f357199a12f02a87382d429b75 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=15.2.0 + constrains: + - libgfortran 15.2.0 + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 2482475 + timestamp: 1771378241063 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libglib-2.86.4-h6548e54_1.conda + sha256: a27e44168a1240b15659888ce0d9b938ed4bdb49e9ea68a7c1ff27bcea8b55ce + md5: bb26456332b07f68bf3b7622ed71c0da + depends: + - __glibc >=2.17,<3.0.a0 + - libffi >=3.5.2,<3.6.0a0 + - libgcc >=14 + - libiconv >=1.18,<2.0a0 + - libzlib >=1.3.1,<2.0a0 + - pcre2 >=10.47,<10.48.0a0 + constrains: + - glib 2.86.4 *_1 + license: LGPL-2.1-or-later + size: 4398701 + timestamp: 1771863239578 - conda: https://conda.anaconda.org/conda-forge/linux-64/libgomp-15.2.0-he0feb66_18.conda sha256: 21337ab58e5e0649d869ab168d4e609b033509de22521de1bfed0c031bfc5110 md5: 239c5e9546c38a1e884d69effcf4c882 @@ -277,6 +1683,40 @@ packages: license_family: GPL size: 603262 timestamp: 1771378117851 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libiconv-1.18-h3b78370_2.conda + sha256: c467851a7312765447155e071752d7bf9bf44d610a5687e32706f480aad2833f + md5: 915f5995e94f60e9a4826e0b0920ee88 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + license: LGPL-2.1-only + size: 790176 + timestamp: 1754908768807 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libjpeg-turbo-3.1.4.1-hb03c661_0.conda + sha256: 10056646c28115b174de81a44e23e3a0a3b95b5347d2e6c45cc6d49d35294256 + md5: 6178c6f2fb254558238ef4e6c56fb782 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + constrains: + - jpeg <0.0.0a + license: IJG AND BSD-3-Clause AND Zlib + size: 633831 + timestamp: 1775962768273 +- conda: https://conda.anaconda.org/conda-forge/linux-64/liblapack-3.11.0-6_h47877c9_openblas.conda + build_number: 6 + sha256: 371f517eb7010b21c6cc882c7606daccebb943307cb9a3bf2c70456a5c024f7d + md5: 881d801569b201c2e753f03c84b85e15 + depends: + - libblas 3.11.0 6_h4a7cf45_openblas + constrains: + - blas 2.306 openblas + - liblapacke 3.11.0 6*_openblas + - libcblas 3.11.0 6*_openblas + license: BSD-3-Clause + license_family: BSD + size: 18624 + timestamp: 1774503065378 - conda: https://conda.anaconda.org/conda-forge/linux-64/liblzma-5.8.3-hb03c661_0.conda sha256: ec30e52a3c1bf7d0425380a189d209a52baa03f22fb66dd3eb587acaa765bd6d md5: b88d90cad08e6bc8ad540cb310a761fb @@ -298,6 +1738,66 @@ packages: license_family: BSD size: 92400 timestamp: 1769482286018 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libnghttp2-1.68.1-h877daf1_0.conda + sha256: 663444d77a42f2265f54fb8b48c5450bfff4388d9c0f8253dd7855f0d993153f + md5: 2a45e7f8af083626f009645a6481f12d + depends: + - __glibc >=2.17,<3.0.a0 + - c-ares >=1.34.6,<2.0a0 + - libev >=4.33,<4.34.0a0 + - libev >=4.33,<5.0a0 + - libgcc >=14 + - libstdcxx >=14 + - libzlib >=1.3.1,<2.0a0 + - openssl >=3.5.5,<4.0a0 + license: MIT + license_family: MIT + size: 663344 + timestamp: 1773854035739 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libopenblas-0.3.32-pthreads_h94d23a6_0.conda + sha256: 6dc30b28f32737a1c52dada10c8f3a41bc9e021854215efca04a7f00487d09d9 + md5: 89d61bc91d3f39fda0ca10fcd3c68594 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libgfortran + - libgfortran5 >=14.3.0 + constrains: + - openblas >=0.3.32,<0.3.33.0a0 + license: BSD-3-Clause + license_family: BSD + size: 5928890 + timestamp: 1774471724897 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libpng-1.6.58-h421ea60_0.conda + sha256: 377cfe037f3eeb3b1bf3ad333f724a64d32f315ee1958581fc671891d63d3f89 + md5: eba48a68a1a2b9d3c0d9511548db85db + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libzlib >=1.3.2,<2.0a0 + license: zlib-acknowledgement + size: 317729 + timestamp: 1776315175087 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libsanitizer-15.2.0-h90f66d4_18.conda + sha256: 0329e23d54a567c259adc962a62172eaa55e6ca33c105ef67b4f3cdb4ef70eaa + md5: ff754fbe790d4e70cf38aea3668c3cb3 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=15.2.0 + - libstdcxx >=15.2.0 + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 8095113 + timestamp: 1771378289674 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libsodium-1.0.21-h280c20c_3.conda + sha256: 64e5c80cbce4680a2d25179949739a6def695d72c40ca28f010711764e372d97 + md5: 7af961ef4aa2c1136e11dd43ded245ab + depends: + - libgcc >=14 + - __glibc >=2.17,<3.0.a0 + license: ISC + size: 277661 + timestamp: 1772479381288 - conda: https://conda.anaconda.org/conda-forge/linux-64/libsqlite-3.53.0-hf4e2dac_0.conda sha256: ec37c79f737933bbac965f5dc0f08ef2790247129a84bb3114fad4900adce401 md5: 810d83373448da85c3f673fbcb7ad3a3 @@ -309,6 +1809,18 @@ packages: license: blessing size: 958864 timestamp: 1775753750179 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libssh2-1.11.1-hcf80075_0.conda + sha256: fa39bfd69228a13e553bd24601332b7cfeb30ca11a3ca50bb028108fe90a7661 + md5: eecce068c7e4eddeb169591baac20ac4 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + - libzlib >=1.3.1,<2.0a0 + - openssl >=3.5.0,<4.0a0 + license: BSD-3-Clause + license_family: BSD + size: 304790 + timestamp: 1745608545575 - conda: https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-15.2.0-h934c35e_18.conda sha256: 78668020064fdaa27e9ab65cd2997e2c837b564ab26ce3bf0e58a2ce1a525c6e md5: 1b08cd684f34175e4514474793d44bcb @@ -321,6 +1833,41 @@ packages: license_family: GPL size: 5852330 timestamp: 1771378262446 +- conda: https://conda.anaconda.org/conda-forge/noarch/libstdcxx-devel_linux-64-15.2.0-hd446a21_118.conda + sha256: 138ee40ba770abf4556ee9981879da9e33299f406a450831b48c1c397d7d0833 + md5: a50630d1810916fc252b2152f1dc9d6d + depends: + - __unix + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 20669511 + timestamp: 1771378139786 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-ng-15.2.0-hdf11a46_18.conda + sha256: 3c902ffd673cb3c6ddde624cdb80f870b6c835f8bf28384b0016e7d444dd0145 + md5: 6235adb93d064ecdf3d44faee6f468de + depends: + - libstdcxx 15.2.0 h934c35e_18 + license: GPL-3.0-only WITH GCC-exception-3.1 + license_family: GPL + size: 27575 + timestamp: 1771378314494 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libtiff-4.7.1-h9d88235_1.conda + sha256: e5f8c38625aa6d567809733ae04bb71c161a42e44a9fa8227abe61fa5c60ebe0 + md5: cd5a90476766d53e901500df9215e927 + depends: + - __glibc >=2.17,<3.0.a0 + - lerc >=4.0.0,<5.0a0 + - libdeflate >=1.25,<1.26.0a0 + - libgcc >=14 + - libjpeg-turbo >=3.1.0,<4.0a0 + - liblzma >=5.8.1,<6.0a0 + - libstdcxx >=14 + - libwebp-base >=1.6.0,<2.0a0 + - libzlib >=1.3.1,<2.0a0 + - zstd >=1.5.7,<1.6.0a0 + license: HPND + size: 435273 + timestamp: 1762022005702 - conda: https://conda.anaconda.org/conda-forge/linux-64/libuuid-2.42-h5347b49_0.conda sha256: bc1b08c92626c91500fd9f26f2c797f3eb153b627d53e9c13cd167f1e12b2829 md5: 38ffe67b78c9d4de527be8315e5ada2c @@ -331,18 +1878,97 @@ packages: license_family: BSD size: 40297 timestamp: 1775052476770 -- conda: https://conda.anaconda.org/conda-forge/linux-64/libzlib-1.3.2-h25fd6f3_2.conda - sha256: 55044c403570f0dc26e6364de4dc5368e5f3fc7ff103e867c487e2b5ab2bcda9 - md5: d87ff7921124eccd67248aa483c23fec +- conda: https://conda.anaconda.org/conda-forge/linux-64/libwebp-base-1.6.0-hd42ef1d_0.conda + sha256: 3aed21ab28eddffdaf7f804f49be7a7d701e8f0e46c856d801270b470820a37b + md5: aea31d2e5b1091feca96fcfe945c3cf9 depends: - __glibc >=2.17,<3.0.a0 + - libgcc >=14 constrains: - - zlib 1.3.2 *_2 - license: Zlib - license_family: Other - size: 63629 - timestamp: 1774072609062 -- conda: https://conda.anaconda.org/conda-forge/noarch/matplotlib-inline-0.2.1-pyhd8ed1ab_0.conda + - libwebp 1.6.0 + license: BSD-3-Clause + license_family: BSD + size: 429011 + timestamp: 1752159441324 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libxcb-1.17.0-h8a09558_0.conda + sha256: 666c0c431b23c6cec6e492840b176dde533d48b7e6fb8883f5071223433776aa + md5: 92ed62436b625154323d40d5f2f11dd7 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + - pthread-stubs + - xorg-libxau >=1.0.11,<2.0a0 + - xorg-libxdmcp + license: MIT + license_family: MIT + size: 395888 + timestamp: 1727278577118 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libxml2-2.15.3-h49c6c72_0.conda + sha256: 3bc5551720c58591f6ea1146f7d1539c734ed1c40e7b9f5cb8cb7e900c509aba + md5: 995d8c8bad2a3cc8db14675a153dec2b + depends: + - __glibc >=2.17,<3.0.a0 + - icu >=78.3,<79.0a0 + - libgcc >=14 + - libiconv >=1.18,<2.0a0 + - liblzma >=5.8.3,<6.0a0 + - libxml2-16 2.15.3 hca6bf5a_0 + - libzlib >=1.3.2,<2.0a0 + license: MIT + license_family: MIT + size: 46810 + timestamp: 1776376751152 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libxml2-16-2.15.3-hca6bf5a_0.conda + sha256: 3d44f737c5ae52d5af32682cc1530df433f401f8e58a7533926536244127572a + md5: e79d2c2f24b027aa8d5ab1b1ba3061e7 + depends: + - __glibc >=2.17,<3.0.a0 + - icu >=78.3,<79.0a0 + - libgcc >=14 + - libiconv >=1.18,<2.0a0 + - liblzma >=5.8.3,<6.0a0 + - libzlib >=1.3.2,<2.0a0 + constrains: + - libxml2 2.15.3 + license: MIT + license_family: MIT + size: 559775 + timestamp: 1776376739004 +- conda: https://conda.anaconda.org/conda-forge/linux-64/libzlib-1.3.2-h25fd6f3_2.conda + sha256: 55044c403570f0dc26e6364de4dc5368e5f3fc7ff103e867c487e2b5ab2bcda9 + md5: d87ff7921124eccd67248aa483c23fec + depends: + - __glibc >=2.17,<3.0.a0 + constrains: + - zlib 1.3.2 *_2 + license: Zlib + license_family: Other + size: 63629 + timestamp: 1774072609062 +- conda: https://conda.anaconda.org/conda-forge/linux-64/make-4.4.1-hb9d3cd8_2.conda + sha256: d652c7bd4d3b6f82b0f6d063b0d8df6f54cc47531092d7ff008e780f3261bdda + md5: 33405d2a66b1411db9f7242c8b97c9e7 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + license: GPL-3.0-or-later + license_family: GPL + size: 513088 + timestamp: 1727801714848 +- conda: https://conda.anaconda.org/conda-forge/noarch/markupsafe-3.0.3-pyh7db6752_1.conda + sha256: 07b5ce26eb0baada927fb29857ebb124bcaa04cb1611e3c0311b66b89c38b875 + md5: 10eb521188e6a175f4c5544b0f9fc7e3 + depends: + - python >=3.10 + constrains: + - jinja2 >=3.0.0 + track_features: + - markupsafe_no_compile + license: BSD-3-Clause + license_family: BSD + size: 15917 + timestamp: 1772445082 +- conda: https://conda.anaconda.org/conda-forge/noarch/matplotlib-inline-0.2.1-pyhd8ed1ab_0.conda sha256: 9d690334de0cd1d22c51bc28420663f4277cfa60d34fa5cad1ce284a13f1d603 md5: 00e120ce3e40bad7bfc78861ce3c4a25 depends: @@ -352,6 +1978,17 @@ packages: license_family: BSD size: 15175 timestamp: 1761214578417 +- conda: https://conda.anaconda.org/conda-forge/noarch/mistune-3.2.0-pyhcf101f3_0.conda + sha256: d3fb4beb5e0a52b6cc33852c558e077e1bfe44df1159eb98332d69a264b14bae + md5: b11e360fc4de2b0035fc8aaa74f17fd6 + depends: + - python >=3.10 + - typing_extensions + - python + license: BSD-3-Clause + license_family: BSD + size: 74250 + timestamp: 1766504456031 - conda: https://conda.anaconda.org/conda-forge/noarch/mypy_extensions-1.1.0-pyha770c72_0.conda sha256: 6ed158e4e5dd8f6a10ad9e525631e35cee8557718f83de7a4e3966b1f772c4b1 md5: e9c622e0d00fa24a6292279af3ab6d06 @@ -361,6 +1998,60 @@ packages: license_family: MIT size: 11766 timestamp: 1745776666688 +- conda: https://conda.anaconda.org/conda-forge/noarch/nbclient-0.10.4-pyhd8ed1ab_0.conda + sha256: 1b66960ee06874ddceeebe375d5f17fb5f393d025a09e15b830ad0c4fffb585b + md5: 00f5b8dafa842e0c27c1cd7296aa4875 + depends: + - jupyter_client >=6.1.12 + - jupyter_core >=4.12,!=5.0.* + - nbformat >=5.1 + - python >=3.8 + - traitlets >=5.4 + license: BSD-3-Clause + license_family: BSD + size: 28473 + timestamp: 1766485646962 +- conda: https://conda.anaconda.org/conda-forge/noarch/nbconvert-core-7.17.1-pyhcf101f3_0.conda + sha256: ab2ac79c5892c5434d50b3542d96645bdaa06d025b6e03734be29200de248ac2 + md5: 2bce0d047658a91b99441390b9b27045 + depends: + - beautifulsoup4 + - bleach-with-css !=5.0.0 + - defusedxml + - importlib-metadata >=3.6 + - jinja2 >=3.0 + - jupyter_core >=4.7 + - jupyterlab_pygments + - markupsafe >=2.0 + - mistune >=2.0.3,<4 + - nbclient >=0.5.0 + - nbformat >=5.7 + - packaging + - pandocfilters >=1.4.1 + - pygments >=2.4.1 + - python >=3.10 + - traitlets >=5.1 + - python + constrains: + - pandoc >=2.9.2,<4.0.0 + - nbconvert ==7.17.1 *_0 + license: BSD-3-Clause + license_family: BSD + size: 202229 + timestamp: 1775615493260 +- conda: https://conda.anaconda.org/conda-forge/noarch/nbformat-5.10.4-pyhd8ed1ab_1.conda + sha256: 7a5bd30a2e7ddd7b85031a5e2e14f290898098dc85bea5b3a5bf147c25122838 + md5: bbe1963f1e47f594070ffe87cdf612ea + depends: + - jsonschema >=2.6 + - jupyter_core >=4.12,!=5.0.* + - python >=3.9 + - python-fastjsonschema >=2.15 + - traitlets >=5.1 + license: BSD-3-Clause + license_family: BSD + size: 100945 + timestamp: 1733402844974 - conda: https://conda.anaconda.org/conda-forge/noarch/nbqa-1.9.0-pyhd8ed1ab_0.conda sha256: cf2323ebaf70dd55bda9292b008975c134896091c550d881eca4cb5669b09afd md5: 44f74c1a5386ea4d95a0f34314f68517 @@ -384,6 +2075,59 @@ packages: license: X11 AND BSD-3-Clause size: 891641 timestamp: 1738195959188 +- conda: https://conda.anaconda.org/conda-forge/noarch/nest-asyncio-1.6.0-pyhd8ed1ab_1.conda + sha256: bb7b21d7fd0445ddc0631f64e66d91a179de4ba920b8381f29b9d006a42788c0 + md5: 598fd7d4d0de2455fb74f56063969a97 + depends: + - python >=3.9 + license: BSD-2-Clause + license_family: BSD + size: 11543 + timestamp: 1733325673691 +- conda: https://conda.anaconda.org/conda-forge/noarch/notebook-7.5.5-pyhcf101f3_0.conda + sha256: 11cfeabc41ed73bb088315d96cfdfeaaa10470c06ce6332bae368590e3047ef6 + md5: 471096452091ae8c460928ad5ff143cc + depends: + - importlib_resources >=5.0 + - jupyter_server >=2.4.0,<3 + - jupyterlab >=4.5.6,<4.6 + - jupyterlab_server >=2.28.0,<3 + - notebook-shim >=0.2,<0.3 + - python >=3.10 + - tornado >=6.2.0 + - python + license: BSD-3-Clause + license_family: BSD + size: 10113914 + timestamp: 1773250273088 +- conda: https://conda.anaconda.org/conda-forge/noarch/notebook-shim-0.2.4-pyhd8ed1ab_1.conda + sha256: 7b920e46b9f7a2d2aa6434222e5c8d739021dbc5cc75f32d124a8191d86f9056 + md5: e7f89ea5f7ea9401642758ff50a2d9c1 + depends: + - jupyter_server >=1.8,<3 + - python >=3.9 + license: BSD-3-Clause + license_family: BSD + size: 16817 + timestamp: 1733408419340 +- conda: https://conda.anaconda.org/conda-forge/linux-64/numpy-2.4.3-py313hf6604e3_0.conda + sha256: bcf75998ea3ae133df3580fb427d1054b006b093799430f499fd7ce8207d34c7 + md5: c4a9d2e77eb9fee983a70cf5f047c202 + depends: + - python + - libstdcxx >=14 + - libgcc >=14 + - __glibc >=2.17,<3.0.a0 + - python_abi 3.13.* *_cp313 + - libcblas >=3.9.0,<4.0a0 + - liblapack >=3.9.0,<4.0a0 + - libblas >=3.9.0,<4.0a0 + constrains: + - numpy-base <0a0 + license: BSD-3-Clause + license_family: BSD + size: 8857056 + timestamp: 1773839226294 - conda: https://conda.anaconda.org/conda-forge/linux-64/openssl-3.6.2-h35e630c_0.conda sha256: c0ef482280e38c71a08ad6d71448194b719630345b0c9c60744a2010e8a8e0cb md5: da1b85b6a87e141f5140bb9924cecab0 @@ -395,6 +2139,16 @@ packages: license_family: Apache size: 3167099 timestamp: 1775587756857 +- conda: https://conda.anaconda.org/conda-forge/noarch/overrides-7.7.0-pyhd8ed1ab_1.conda + sha256: 1840bd90d25d4930d60f57b4f38d4e0ae3f5b8db2819638709c36098c6ba770c + md5: e51f1e4089cad105b6cac64bd8166587 + depends: + - python >=3.9 + - typing_utils + license: Apache-2.0 + license_family: APACHE + size: 30139 + timestamp: 1734587755455 - conda: https://conda.anaconda.org/conda-forge/noarch/packaging-26.1-pyhc364b38_0.conda sha256: 171d977bc977fd80f2a05de3d4b7d571c4ec3cdea436ed364e5cd50547c50881 md5: b8ae38639d323d808da535fb71e31be8 @@ -405,6 +2159,97 @@ packages: license_family: APACHE size: 89360 timestamp: 1776209387231 +- conda: https://conda.anaconda.org/conda-forge/linux-64/pandas-3.0.2-py313hbfd7664_0.conda + sha256: 6aa7b7b234805c673fd63ef60432362e6cc130a3ae09b5ed2b40d74a2bd6c7bb + md5: 6a036e42f4e47720804f35d1897336a1 + depends: + - python + - numpy >=1.26.0 + - python-dateutil >=2.8.2 + - libgcc >=14 + - libstdcxx >=14 + - __glibc >=2.17,<3.0.a0 + - numpy >=1.23,<3 + - python_abi 3.13.* *_cp313 + constrains: + - adbc-driver-postgresql >=1.2.0 + - adbc-driver-sqlite >=1.2.0 + - beautifulsoup4 >=4.12.3 + - blosc >=1.21.3 + - bottleneck >=1.4.2 + - fastparquet >=2024.11.0 + - fsspec >=2024.10.0 + - gcsfs >=2024.10.0 + - html5lib >=1.1 + - hypothesis >=6.116.0 + - jinja2 >=3.1.5 + - lxml >=5.3.0 + - matplotlib >=3.9.3 + - numba >=0.60.0 + - numexpr >=2.10.2 + - odfpy >=1.4.1 + - openpyxl >=3.1.5 + - psycopg2 >=2.9.10 + - pyarrow >=13.0.0 + - pyiceberg >=0.8.1 + - pymysql >=1.1.1 + - pyqt5 >=5.15.9 + - pyreadstat >=1.2.8 + - pytables >=3.10.1 + - pytest >=8.3.4 + - pytest-xdist >=3.6.1 + - python-calamine >=0.3.0 + - pytz >=2024.2 + - pyxlsb >=1.0.10 + - qtpy >=2.4.2 + - scipy >=1.14.1 + - s3fs >=2024.10.0 + - sqlalchemy >=2.0.36 + - tabulate >=0.9.0 + - xarray >=2024.10.0 + - xlrd >=2.0.1 + - xlsxwriter >=3.2.0 + - zstandard >=0.23.0 + license: BSD-3-Clause + license_family: BSD + size: 14980998 + timestamp: 1774916581833 +- conda: https://conda.anaconda.org/conda-forge/linux-64/pandoc-3.9.0.2-ha770c72_0.conda + sha256: d46f76ed09396e3bd1dc11030b3d0d222c25ba8d92f3cde08bc6fbd1eec4f9e0 + md5: de8ccf9ffba55bd20ee56301cfc7e6db + license: GPL-2.0-or-later + license_family: GPL + size: 22364689 + timestamp: 1773933354952 +- conda: https://conda.anaconda.org/conda-forge/noarch/pandocfilters-1.5.0-pyhd8ed1ab_0.tar.bz2 + sha256: 2bb9ba9857f4774b85900c2562f7e711d08dd48e2add9bee4e1612fbee27e16f + md5: 457c2c8c08e54905d6954e79cb5b5db9 + depends: + - python !=3.0,!=3.1,!=3.2,!=3.3 + license: BSD-3-Clause + license_family: BSD + size: 11627 + timestamp: 1631603397334 +- conda: https://conda.anaconda.org/conda-forge/linux-64/pango-1.56.4-hda50119_1.conda + sha256: 315b52bfa6d1a820f4806f6490d472581438a28e21df175290477caec18972b0 + md5: d53ffc0edc8eabf4253508008493c5bc + depends: + - __glibc >=2.17,<3.0.a0 + - cairo >=1.18.4,<2.0a0 + - fontconfig >=2.17.1,<3.0a0 + - fonts-conda-ecosystem + - fribidi >=1.0.16,<2.0a0 + - harfbuzz >=13.2.1 + - libexpat >=2.7.4,<3.0a0 + - libfreetype >=2.14.2 + - libfreetype6 >=2.14.2 + - libgcc >=14 + - libglib >=2.86.4,<3.0a0 + - libpng >=1.6.55,<1.7.0a0 + - libzlib >=1.3.2,<2.0a0 + license: LGPL-2.1-or-later + size: 458036 + timestamp: 1774281947855 - conda: https://conda.anaconda.org/conda-forge/noarch/parso-0.8.6-pyhcf101f3_0.conda sha256: 42b2d77ccea60752f3aa929a6413a7835aaacdbbde679f2f5870a744fa836b94 md5: 97c1ce2fffa1209e7afb432810ec6e12 @@ -419,136 +2264,1981 @@ packages: sha256: 29ea20d0faf20374fcd61c25f6d32fb8e9a2c786a7f1473a0c3ead359470fbe1 md5: 2908273ac396d2cd210a8127f5f1c0d6 depends: - - python >=3.10 - license: MPL-2.0 - license_family: MOZILLA - size: 53739 - timestamp: 1769677743677 -- conda: https://conda.anaconda.org/conda-forge/noarch/pexpect-4.9.0-pyhd8ed1ab_1.conda - sha256: 202af1de83b585d36445dc1fda94266697341994d1a3328fabde4989e1b3d07a - md5: d0d408b1f18883a944376da5cf8101ea + - python >=3.10 + license: MPL-2.0 + license_family: MOZILLA + size: 53739 + timestamp: 1769677743677 +- conda: https://conda.anaconda.org/conda-forge/linux-64/pcre2-10.47-haa7fec5_0.conda + sha256: 5e6f7d161356fefd981948bea5139c5aa0436767751a6930cb1ca801ebb113ff + md5: 7a3bff861a6583f1889021facefc08b1 + depends: + - __glibc >=2.17,<3.0.a0 + - bzip2 >=1.0.8,<2.0a0 + - libgcc >=14 + - libzlib >=1.3.1,<2.0a0 + license: BSD-3-Clause + license_family: BSD + size: 1222481 + timestamp: 1763655398280 +- conda: https://conda.anaconda.org/conda-forge/noarch/pexpect-4.9.0-pyhd8ed1ab_1.conda + sha256: 202af1de83b585d36445dc1fda94266697341994d1a3328fabde4989e1b3d07a + md5: d0d408b1f18883a944376da5cf8101ea + depends: + - ptyprocess >=0.5 + - python >=3.9 + license: ISC + size: 53561 + timestamp: 1733302019362 +- conda: https://conda.anaconda.org/conda-forge/linux-64/pixman-0.46.4-h54a6638_1.conda + sha256: 43d37bc9ca3b257c5dd7bf76a8426addbdec381f6786ff441dc90b1a49143b6a + md5: c01af13bdc553d1a8fbfff6e8db075f0 + depends: + - libgcc >=14 + - libstdcxx >=14 + - libgcc >=14 + - __glibc >=2.17,<3.0.a0 + license: MIT + license_family: MIT + size: 450960 + timestamp: 1754665235234 +- conda: https://conda.anaconda.org/conda-forge/noarch/platformdirs-4.9.6-pyhcf101f3_0.conda + sha256: 8f29915c172f1f7f4f7c9391cd5dac3ebf5d13745c8b7c8006032615246345a5 + md5: 89c0b6d1793601a2a3a3f7d2d3d8b937 + depends: + - python >=3.10 + - python + license: MIT + license_family: MIT + size: 25862 + timestamp: 1775741140609 +- conda: https://conda.anaconda.org/conda-forge/noarch/prometheus_client-0.25.0-pyhd8ed1ab_0.conda + sha256: 4d7ec90d4f9c1f3b4a50623fefe4ebba69f651b102b373f7c0e9dbbfa43d495c + md5: a11ab1f31af799dd93c3a39881528884 + depends: + - python >=3.10 + license: Apache-2.0 + license_family: Apache + size: 57113 + timestamp: 1775771465170 +- conda: https://conda.anaconda.org/conda-forge/noarch/prompt-toolkit-3.0.52-pyha770c72_0.conda + sha256: 4817651a276016f3838957bfdf963386438c70761e9faec7749d411635979bae + md5: edb16f14d920fb3faf17f5ce582942d6 + depends: + - python >=3.10 + - wcwidth + constrains: + - prompt_toolkit 3.0.52 + license: BSD-3-Clause + license_family: BSD + size: 273927 + timestamp: 1756321848365 +- conda: https://conda.anaconda.org/conda-forge/noarch/prompt_toolkit-3.0.52-hd8ed1ab_0.conda + sha256: e79922a360d7e620df978417dd033e66226e809961c3e659a193f978a75a9b0b + md5: 6d034d3a6093adbba7b24cb69c8c621e + depends: + - prompt-toolkit >=3.0.52,<3.0.53.0a0 + license: BSD-3-Clause + license_family: BSD + size: 7212 + timestamp: 1756321849562 +- conda: https://conda.anaconda.org/conda-forge/linux-64/psutil-7.2.2-py313h54dd161_0.conda + sha256: f19fd682d874689dfde20bf46d7ec1a28084af34583e0405685981363af47c91 + md5: 25fe6e02c2083497b3239e21b49d8093 + depends: + - python + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - python_abi 3.13.* *_cp313 + license: BSD-3-Clause + license_family: BSD + size: 228663 + timestamp: 1769678153829 +- conda: https://conda.anaconda.org/conda-forge/linux-64/pthread-stubs-0.4-hb9d3cd8_1002.conda + sha256: 9c88f8c64590e9567c6c80823f0328e58d3b1efb0e1c539c0315ceca764e0973 + md5: b3c17d95b5a10c6e64a21fa17573e70e + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + license: MIT + license_family: MIT + size: 8252 + timestamp: 1726802366959 +- conda: https://conda.anaconda.org/conda-forge/noarch/ptyprocess-0.7.0-pyhd8ed1ab_1.conda + sha256: a7713dfe30faf17508ec359e0bc7e0983f5d94682492469bd462cdaae9c64d83 + md5: 7d9daffbb8d8e0af0f769dbbcd173a54 + depends: + - python >=3.9 + license: ISC + size: 19457 + timestamp: 1733302371990 +- conda: https://conda.anaconda.org/conda-forge/noarch/pure_eval-0.2.3-pyhd8ed1ab_1.conda + sha256: 71bd24600d14bb171a6321d523486f6a06f855e75e547fa0cb2a0953b02047f0 + md5: 3bfdfb8dbcdc4af1ae3f9a8eb3948f04 + depends: + - python >=3.9 + license: MIT + license_family: MIT + size: 16668 + timestamp: 1733569518868 +- conda: https://conda.anaconda.org/conda-forge/noarch/pycodestyle-2.14.0-pyhd8ed1ab_0.conda + sha256: 1950f71ff44e64163e176b1ca34812afc1a104075c3190de50597e1623eb7d53 + md5: 85815c6a22905c080111ec8d56741454 + depends: + - python >=3.9 + license: MIT + license_family: MIT + size: 35182 + timestamp: 1750616054854 +- conda: https://conda.anaconda.org/conda-forge/noarch/pycparser-2.22-pyh29332c3_1.conda + sha256: 79db7928d13fab2d892592223d7570f5061c192f27b9febd1a418427b719acc6 + md5: 12c566707c80111f9799308d9e265aef + depends: + - python >=3.9 + - python + license: BSD-3-Clause + license_family: BSD + size: 110100 + timestamp: 1733195786147 +- conda: https://conda.anaconda.org/conda-forge/noarch/pygments-2.20.0-pyhd8ed1ab_0.conda + sha256: cf70b2f5ad9ae472b71235e5c8a736c9316df3705746de419b59d442e8348e86 + md5: 16c18772b340887160c79a6acc022db0 + depends: + - python >=3.10 + license: BSD-2-Clause + license_family: BSD + size: 893031 + timestamp: 1774796815820 +- conda: https://conda.anaconda.org/conda-forge/noarch/pysocks-1.7.1-pyha55dd90_7.conda + sha256: ba3b032fa52709ce0d9fd388f63d330a026754587a2f461117cac9ab73d8d0d8 + md5: 461219d1a5bd61342293efa2c0c90eac + depends: + - __unix + - python >=3.9 + license: BSD-3-Clause + license_family: BSD + size: 21085 + timestamp: 1733217331982 +- conda: https://conda.anaconda.org/conda-forge/linux-64/python-3.13.13-h6add32d_100_cp313.conda + build_number: 100 + sha256: 7f77eb57648f545c1f58e10035d0d9d66b0a0efb7c4b58d3ed89ec7269afdde1 + md5: 05051be49267378d2fcd12931e319ac3 + depends: + - __glibc >=2.17,<3.0.a0 + - bzip2 >=1.0.8,<2.0a0 + - ld_impl_linux-64 >=2.36.1 + - libexpat >=2.7.5,<3.0a0 + - libffi >=3.5.2,<3.6.0a0 + - libgcc >=14 + - liblzma >=5.8.2,<6.0a0 + - libmpdec >=4.0.0,<5.0a0 + - libsqlite >=3.52.0,<4.0a0 + - libuuid >=2.42,<3.0a0 + - libzlib >=1.3.2,<2.0a0 + - ncurses >=6.5,<7.0a0 + - openssl >=3.5.6,<4.0a0 + - python_abi 3.13.* *_cp313 + - readline >=8.3,<9.0a0 + - tk >=8.6.13,<8.7.0a0 + - tzdata + license: Python-2.0 + size: 37358322 + timestamp: 1775614712638 + python_site_packages_path: lib/python3.13/site-packages +- conda: https://conda.anaconda.org/conda-forge/noarch/python-dateutil-2.9.0.post0-pyhe01879c_2.conda + sha256: d6a17ece93bbd5139e02d2bd7dbfa80bee1a4261dced63f65f679121686bf664 + md5: 5b8d21249ff20967101ffa321cab24e8 + depends: + - python >=3.9 + - six >=1.5 + - python + license: Apache-2.0 + license_family: APACHE + size: 233310 + timestamp: 1751104122689 +- conda: https://conda.anaconda.org/conda-forge/noarch/python-fastjsonschema-2.21.2-pyhe01879c_0.conda + sha256: df9aa74e9e28e8d1309274648aac08ec447a92512c33f61a8de0afa9ce32ebe8 + md5: 23029aae904a2ba587daba708208012f + depends: + - python >=3.9 + - python + license: BSD-3-Clause + license_family: BSD + size: 244628 + timestamp: 1755304154927 +- conda: https://conda.anaconda.org/conda-forge/noarch/python-gil-3.13.13-h4df99d1_100.conda + sha256: b2e51d83e5ebeb7e9fde1cde822a60e8564cc9dabd786ad853056afbf708a466 + md5: fd00e4b24ea88093c93f5c9bad27b52f + depends: + - cpython 3.13.13.* + - python_abi * *_cp313 + license: Python-2.0 + size: 48536 + timestamp: 1775613791711 +- conda: https://conda.anaconda.org/conda-forge/noarch/python-json-logger-2.0.7-pyhd8ed1ab_0.conda + sha256: 4790787fe1f4e8da616edca4acf6a4f8ed4e7c6967aa31b920208fc8f95efcca + md5: a61bf9ec79426938ff785eb69dbb1960 + depends: + - python >=3.6 + license: BSD-2-Clause + license_family: BSD + size: 13383 + timestamp: 1677079727691 +- conda: https://conda.anaconda.org/conda-forge/noarch/python-tzdata-2026.1-pyhd8ed1ab_0.conda + sha256: b5494ef54bc2394c6c4766ceeafac22507c4fc60de6cbfda45524fc2fcc3c9fc + md5: d8d30923ccee7525704599efd722aa16 + depends: + - python >=3.10 + license: Apache-2.0 + license_family: APACHE + size: 147315 + timestamp: 1775223532978 +- conda: https://conda.anaconda.org/conda-forge/noarch/python_abi-3.13-8_cp313.conda + build_number: 8 + sha256: 210bffe7b121e651419cb196a2a63687b087497595c9be9d20ebe97dd06060a7 + md5: 94305520c52a4aa3f6c2b1ff6008d9f8 + constrains: + - python 3.13.* *_cp313 + license: BSD-3-Clause + license_family: BSD + size: 7002 + timestamp: 1752805902938 +- conda: https://conda.anaconda.org/conda-forge/linux-64/pytokens-0.4.1-py313h54dd161_1.conda + sha256: 543302099bbe6b2e77e8a43894dc3894a0bf47e18ea1b0b21ade196f0bdf1ce7 + md5: 8aafbc11caed472c9f7a174f9925fb94 + depends: + - python + - libgcc >=14 + - __glibc >=2.17,<3.0.a0 + - python_abi 3.13.* *_cp313 + license: MIT + license_family: MIT + size: 277555 + timestamp: 1771613648731 +- conda: https://conda.anaconda.org/conda-forge/noarch/pyyaml-6.0.3-pyh7db6752_1.conda + sha256: 5f938d208c284cc1f910fd84f2adffe59d01de73f62d8448ae311eb4f0340bd3 + md5: 1fd14e3bb9bd8dac4caa30da123b8a93 + depends: + - python >=3.10.* + - yaml + track_features: + - pyyaml_no_compile + license: MIT + license_family: MIT + size: 45525 + timestamp: 1770223374054 +- conda: https://conda.anaconda.org/conda-forge/linux-64/pyzmq-27.1.0-py312hda471dd_2.conda + noarch: python + sha256: be66c1f85c3b48137200d62c12d918f4f8ad329423daef04fed292818efd3c28 + md5: 082985717303dab433c976986c674b35 + depends: + - python + - libgcc >=14 + - libstdcxx >=14 + - __glibc >=2.17,<3.0.a0 + - zeromq >=4.3.5,<4.4.0a0 + - _python_abi3_support 1.* + - cpython >=3.12 + license: BSD-3-Clause + license_family: BSD + size: 211567 + timestamp: 1771716961404 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-askpass-1.2.1-r45h54b55ab_1.conda + sha256: 5c4d2bcc1beba7703acbfe1610a846ce2a4010456714705dfa63989cee722a00 + md5: 1ae3c72e90c6a3871c594448d3e152e4 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + - r-sys >=2.1 + license: MIT + license_family: MIT + size: 31983 + timestamp: 1758383536121 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-assertthat-0.2.1-r45hc72bb7e_6.conda + sha256: 90e7ae8aa427274d7d2e510060b68925e60e897ecaa5ea135bb33afa7eb12134 + md5: b5291c60f52b43108a2973ba6f5885d1 + depends: + - r-base >=4.5,<4.6.0a0 + license: GPL-3.0-only + license_family: GPL3 + size: 72543 + timestamp: 1757447376176 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-backports-1.5.1-r45h54b55ab_0.conda + sha256: fee4a4edfc81b45a79fa7da152b8a46cccf5caad6f0fcf86758a55dcb366af63 + md5: dac02364873fe7c75047d7a21741977c + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: GPL-2.0-or-later + license_family: GPL2 + size: 131442 + timestamp: 1775202754185 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-base-4.5.3-h15dba0b_1.conda + sha256: eb21b72dfa6cc767cebc0b348b8da3dc762a7e85627fc7a5afee72cc75e8f89c + md5: 0356c81af70570e685acc134ac740014 + depends: + - __glibc >=2.17,<3.0.a0 + - _openmp_mutex >=4.5 + - _r-mutex 1.* anacondar_1 + - bwidget + - bzip2 >=1.0.8,<2.0a0 + - cairo >=1.18.4,<2.0a0 + - curl + - gcc_impl_linux-64 >=10 + - gfortran_impl_linux-64 + - gsl >=2.7,<2.8.0a0 + - gxx_impl_linux-64 >=10 + - icu >=78.2,<79.0a0 + - libblas >=3.9.0,<4.0a0 + - libcurl >=8.19.0,<9.0a0 + - libdeflate >=1.25,<1.26.0a0 + - libexpat >=2.7.4,<3.0a0 + - libgcc + - libgcc-ng >=12 + - libgfortran + - libgfortran-ng + - libgfortran5 >=10.4.0 + - libglib >=2.86.4,<3.0a0 + - libiconv >=1.18,<2.0a0 + - libjpeg-turbo >=3.1.2,<4.0a0 + - liblapack >=3.9.0,<4.0a0 + - liblzma >=5.8.2,<6.0a0 + - libpng >=1.6.55,<1.7.0a0 + - libstdcxx + - libstdcxx-ng >=12 + - libtiff >=4.7.1,<4.8.0a0 + - libuuid >=2.41.3,<3.0a0 + - libzlib >=1.3.1,<2.0a0 + - make + - pango >=1.56.4,<2.0a0 + - pcre2 >=10.47,<10.48.0a0 + - readline >=8.3,<9.0a0 + - sed + - tk >=8.6.13,<8.7.0a0 + - tktable + - tzdata >=2024a + - xorg-libice >=1.1.2,<2.0a0 + - xorg-libsm >=1.2.6,<2.0a0 + - xorg-libx11 >=1.8.13,<2.0a0 + - xorg-libxt >=1.3.1,<2.0a0 + license: GPL-2.0-or-later + license_family: GPL + size: 27333030 + timestamp: 1773746047753 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-base64enc-0.1_6-r45h54b55ab_0.conda + sha256: 7a3751a340766ee25380a51df70c8356a64cfeb6ac3d982a86e92eb99fec2943 + md5: e573dc135976197e7f819eec202c93f1 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: GPL-2.0-or-later + license_family: GPL3 + size: 48616 + timestamp: 1770027796335 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-bit-4.6.0-r45h54b55ab_1.conda + sha256: f5e7c54332bb79d1f992fa97088e206a1ba8037a1be8c77886e2f63b94a97a85 + md5: 6b666bedcfbe9dee03efb5fb95ac18e1 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: GPL-2.0-or-later + license_family: GPL2 + size: 621466 + timestamp: 1757441575090 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-bit64-4.8.0-r45h54b55ab_0.conda + sha256: da4ac2e210e0f67e836b9877d162ed87a68d4b9e435745ecd6fbe18f9d4f2451 + md5: 51417eba9c38a90a84c07cef833f574b + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + - r-bit >=4.0.0 + license: GPL-2.0-only + license_family: GPL2 + size: 573776 + timestamp: 1776759947092 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-blob-1.3.0-r45hc72bb7e_0.conda + sha256: c939f23050463f3f62d08eaa5bdcd567799ed8f78d5270e50884cfe5ea35048d + md5: a5401d5f7b44aa4b805abc756ddb403a + depends: + - r-base >=4.5,<4.6.0a0 + - r-rlang + - r-vctrs >=0.2.1 + license: GPL-3.0-only + license_family: GPL3 + size: 70126 + timestamp: 1768440582521 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-broom-1.0.12-r45hc72bb7e_0.conda + sha256: 76b5d451395a7cfb11c329af66942605aa7939bf92cf48f324cc97f665cae117 + md5: 7667fa08a0c15931b05876668c6e263f + depends: + - r-backports + - r-base >=4.5,<4.6.0a0 + - r-dplyr >=1.0.0 + - r-ellipsis + - r-generics >=0.0.2 + - r-ggplot2 + - r-glue + - r-purrr + - r-rlang + - r-stringr + - r-tibble >=3.0.0 + - r-tidyr >=1.0.0 + license: MIT + license_family: MIT + size: 1736988 + timestamp: 1769738136793 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-bslib-0.10.0-r45hc72bb7e_0.conda + sha256: a4e8329b0891190fa4fd11a79db95a81e1f6e23a0c780ba67d92dbe40f5bbd37 + md5: b0ab5d18eec0343aaa4790dd78087a87 + depends: + - r-base >=4.5,<4.6.0a0 + - r-base64enc + - r-cachem + - r-htmltools >=0.5.7 + - r-jquerylib >=0.1.3 + - r-jsonlite + - r-lifecycle + - r-memoise >=2.0.1 + - r-mime + - r-rlang + - r-sass >=0.4.0 + license: MIT + license_family: MIT + size: 5484359 + timestamp: 1769433938691 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-cachem-1.1.0-r45h54b55ab_2.conda + sha256: 75a21c955abf03fa1804d47c94f5091cd772b614e074b63b02347a23f5649a53 + md5: 42617e710293f0b76ccc08855e0edbc4 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + - r-fastmap + - r-rlang + license: MIT + license_family: MIT + size: 76879 + timestamp: 1757441544326 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-callr-3.7.6-r45hc72bb7e_2.conda + sha256: f9f49b2b845f279af84a33c8af19a915b2731c0bd892c608205cbad8a34f423d + md5: a5cc8a8d0dc08dc769c65a13b3573739 + depends: + - r-base >=4.5,<4.6.0a0 + - r-processx >=3.4.0 + - r-r6 + license: MIT + license_family: MIT + size: 454090 + timestamp: 1757475635573 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-cellranger-1.1.0-r45hc72bb7e_1008.conda + sha256: b569584749f6725a9739434ac75a6dcd984c2c9ef2d93308fa5a54cd12b19136 + md5: 80237db078ca098045db2a695dace951 + depends: + - r-base >=4.5,<4.6.0a0 + - r-rematch + - r-tibble + license: MIT + license_family: MIT + size: 111771 + timestamp: 1757511312913 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-cli-3.6.6-r45h3697838_0.conda + sha256: a894e558a680a31444090de217b73f8fc06a3f4c07746d2cde4b6f86acdae0b1 + md5: ed8dcbbe9d66e9093ba58891e3b6065a + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 1323795 + timestamp: 1775733704549 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-clipr-0.8.0-r45hc72bb7e_4.conda + sha256: df9c2315dcc8e271947d6fee8d805f1723ce1f41be4369aa820f572d272c042d + md5: 5deda37b255bc9dc837d00b89dbf2a21 + depends: + - r-base >=4.5,<4.6.0a0 + license: GPL-3.0-only + license_family: GPL3 + size: 70829 + timestamp: 1757460210204 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-colorspace-2.1_2-r45h54b55ab_0.conda + sha256: 0499da963641d533d3b210373a2b430301f9f1593c57cb3aa2f790125548ad52 + md5: 9aa495fac7950f962e255cd1af855e95 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: BSD-3-Clause + license_family: BSD + size: 2541378 + timestamp: 1758590590322 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-conflicted-1.2.0-r45h785f33e_3.conda + sha256: c9529b1f5822b8a60dc9488ffcb5182e992c432297d5f76493aa3ee3a74d9297 + md5: 2e8d42c3cdd4847e365942eb7ab3bc33 + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.4.0 + - r-memoise + - r-rlang >=1.0.0 + license: MIT + license_family: MIT + size: 64132 + timestamp: 1757548584605 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-cpp11-0.5.4-r45h785f33e_0.conda + sha256: 32a37046e884f2c4125baff219dc7dc97cfe96c1db7d30355d2414e500a00ca9 + md5: 8ffdfacba9fb160f880ecdc4b450fdf5 + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 243945 + timestamp: 1775286035216 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-crayon-1.5.3-r45hc72bb7e_2.conda + sha256: 9126a0408696133893e674549ca7aef317768dba503765a7ed032616aabe5b49 + md5: 4f111ce078b9690abaad6248b831a370 + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 168201 + timestamp: 1757452410374 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-curl-7.0.0-r45h10955f1_1.conda + sha256: f69d86d1d2020d38a4ba085297e8c3460b58158846232db96e24baf71db279f9 + md5: b51b37b26b8105fa72abe12131165018 + depends: + - __glibc >=2.17,<3.0.a0 + - libcurl >=8.14.1,<9.0a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 479210 + timestamp: 1757581704371 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-data.table-1.17.8-r45h1c8cec4_1.conda + sha256: c9ac7510c18e3258e227575a83f6caf0cc692da3cc2a8c4c344da2463529b07e + md5: d63403a16b7991fa5a6b7b05e110681a + depends: + - __glibc >=2.17,<3.0.a0 + - _openmp_mutex >=4.5 + - libgcc >=14 + - libzlib >=1.3.1,<2.0a0 + - r-base >=4.5,<4.6.0a0 + license: MPL-2.0 + license_family: OTHER + size: 2301313 + timestamp: 1757499556984 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-dbi-1.3.0-r45hc72bb7e_0.conda + sha256: 82dbc27e1db79f9a897626656c3b418a071a681a07f4c47f6f15f98ec12e09fe + md5: 8a912a3730695141b5566202130a11e1 + depends: + - r-base >=4.5,<4.6.0a0 + license: LGPL-2.1-or-later + license_family: LGPL + size: 892756 + timestamp: 1772009847613 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-dbplyr-2.5.2-r45hc72bb7e_0.conda + sha256: d20fb999446dceaa575d458974e5c446ee6807e67c8e5797cca398cf051dd9ac + md5: d1dc488c56da3d0078b552153bd02f74 + depends: + - r-base >=4.5,<4.6.0a0 + - r-blob >=1.2.0 + - r-cli >=3.6.1 + - r-dbi >=1.1.3 + - r-dplyr >=1.1.2 + - r-glue >=1.6.2 + - r-lifecycle >=1.0.3 + - r-magrittr + - r-pillar >=1.9.0 + - r-purrr >=1.0.1 + - r-r6 >=2.2.2 + - r-rlang >=1.1.1 + - r-tibble >=3.2.1 + - r-tidyr >=1.3.0 + - r-tidyselect >=1.2.1 + - r-vctrs >=0.6.3 + - r-withr >=2.5.0 + license: MIT + license_family: MIT + size: 1217410 + timestamp: 1770973839074 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-digest-0.6.39-r45h3697838_0.conda + sha256: 33ce40552bc1810252c4445082392638ff2fb883147cf36c3e4017e9b0dc5474 + md5: a0e856537aa7d62a6835e3a528d29517 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + license: GPL-2.0-or-later + license_family: GPL2 + size: 218412 + timestamp: 1763566744987 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-dplyr-1.2.1-r45h3697838_0.conda + sha256: 42067805b0742b933de7e1ca4311645797ac687cee6aacd630d9d4c585dfa830 + md5: 7c8e643f764769a184f0d0d06ac0e789 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-ellipsis + - r-generics + - r-glue >=1.3.2 + - r-lifecycle >=1.0.0 + - r-magrittr >=1.5 + - r-pillar >=1.5.1 + - r-r6 + - r-rlang >=0.4.10 + - r-tibble >=2.1.3 + - r-tidyselect >=1.1.0 + - r-vctrs >=0.3.5 + license: MIT + license_family: MIT + size: 1445950 + timestamp: 1775207093582 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-dtplyr-1.3.3-r45hc72bb7e_0.conda + sha256: 0870dc668a2f404590e12b995e070bc2f223367fc1b8da8674b609d8589df93c + md5: 316d491fa179824754a3a78d8b0c189e + depends: + - r-base >=4.5,<4.6.0a0 + - r-crayon + - r-data.table >=1.13.0 + - r-dplyr >=1.0.3 + - r-ellipsis + - r-glue + - r-lifecycle + - r-rlang + - r-tibble + - r-tidyselect + - r-vctrs + license: MIT + license_family: MIT + size: 411079 + timestamp: 1770857261206 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-ellipsis-0.3.3-r45h54b55ab_0.conda + sha256: 19d03273f9d5e1aa41302e1cf080dcb95ced5b955bc978df39eee71a9686a86c + md5: e43b3e7101a90ac57f58a21da67c99a4 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + - r-rlang >=0.3.0 + license: MIT + license_family: MIT + size: 33411 + timestamp: 1775287239478 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-evaluate-1.0.5-r45hc72bb7e_1.conda + sha256: d3accfeab1416151515c37e5edc94b18868998db4936183459f8040117d5c83c + md5: 4e0c71ab78d7292372a89d4daecb49af + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 111914 + timestamp: 1757447684244 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-fansi-1.0.7-r45h54b55ab_0.conda + sha256: 68dcc5aa6fc4408f9cac5aeaa03a7e6a5d127a949fc72b3fed31fd1af3bbeee5 + md5: 309740f1b6a2d4cb16d395be786c85c5 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: GPL-2.0-or-later + license_family: GPL3 + size: 329435 + timestamp: 1763566090233 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-farver-2.1.2-r45h3697838_2.conda + sha256: 06c5e73ed5c9c15e7ca944e3a5fabfbcabd9f4aec71804404ecf51c56f78fd8f + md5: 7896efcfd50f8c1f207acce5d4ab1cc0 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 1429269 + timestamp: 1757441256046 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-fastmap-1.2.0-r45h3697838_2.conda + sha256: bfec10cec03b434d9010690c61d43a0be79418f67a0713ce31da207a40e1570c + md5: 245526991ad3b8a1dc97f2dcb5031065 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 73870 + timestamp: 1757421441326 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-fontawesome-0.5.3-r45hc72bb7e_1.conda + sha256: 865df12d8cdd8cf577abc8f785a0aa4ee50b4f8751256dffe4676a350943d591 + md5: e9fccb3617ec9776569c6496fa254e64 + depends: + - r-base >=4.5,<4.6.0a0 + - r-htmltools >=0.5.1.1 + - r-rlang >=0.4.10 + license: MIT + license_family: MIT + size: 1335664 + timestamp: 1757461248044 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-forcats-1.0.1-r45hc72bb7e_0.conda + sha256: c7ef68e66598fc1e22e49bce9a9d309334517d334bd5846f4a90cfe3f49eb33b + md5: 193070c66f09692b1ebf065bcbc06f49 + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-ellipsis + - r-glue + - r-lifecycle + - r-magrittr + - r-rlang >=1.0.0 + - r-tibble + - r-withr + license: MIT + license_family: MIT + size: 424119 + timestamp: 1758793455858 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-fs-1.6.7-r45h3697838_0.conda + sha256: 97d033bc3cc132893e11925eab2a64e5f6daf15c468688cc7364e0613853795e + md5: 68e44c944dd77e9c8455e720a59c64fd + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 518079 + timestamp: 1773966918671 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-gargle-1.6.1-r45h785f33e_0.conda + sha256: 4280b646f855b6e02ed8e0075433cda2096294ae6892da71ac54eae9dfd68af2 + md5: 297c849e7aa150103cccff44987a78b9 + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.0.0 + - r-fs >=1.3.1 + - r-glue >=1.3.0 + - r-httr >=1.4.0 + - r-jsonlite + - r-lifecycle + - r-openssl + - r-rappdirs + - r-rlang >=1.0.0 + - r-rstudioapi + - r-withr + license: MIT + license_family: MIT + size: 724140 + timestamp: 1769689631667 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-generics-0.1.4-r45hc72bb7e_1.conda + sha256: 88a5cf4bac0a553943996bc930b1ea28f2635c262c1b2c5a42b026b69f227f02 + md5: f19c9493b80f63a41fa017ec3b27bc2e + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 88225 + timestamp: 1757455977192 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-ggplot2-4.0.3-r45h785f33e_0.conda + sha256: 3a91d5334b7d99bc247386eaf0d331e119852e381e769e266f70df20eab22689 + md5: 866fbbf3f356140922d618f26f2b889c + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-glue + - r-gtable >=0.3.6 + - r-isoband + - r-lifecycle >=1.0.1 + - r-rlang >=1.1.0 + - r-s7 + - r-scales >=1.4.0 + - r-vctrs >=0.6.0 + - r-withr >=2.5.0 + license: MIT + license_family: MIT + size: 7812326 + timestamp: 1776860393567 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-glue-1.8.1-r45h54b55ab_0.conda + sha256: c2760270ffabd95e9d0a0caa9cc705c5a0370ad119ace5495acc043b1a35d198 + md5: 65911c2e9cac35ea0235d3d6d4aa9625 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 171639 + timestamp: 1776413601349 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-googledrive-2.1.2-r45hc72bb7e_1.conda + sha256: e8430c55adf0b4126673c142b0e785ff10e037a293a8ffe8964e9a9797d5a3d0 + md5: 93b80086476d2653a3998e4fd174bad9 + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.0.0 + - r-gargle >=1.6.0 + - r-glue >=1.4.2 + - r-httr + - r-jsonlite + - r-lifecycle + - r-magrittr + - r-pillar >=1.9.0 + - r-purrr >=1.0.1 + - r-rlang >=1.0.2 + - r-tibble >=2.0.0 + - r-uuid + - r-vctrs >=0.3.0 + - r-withr + license: MIT + license_family: MIT + size: 1233702 + timestamp: 1758449343569 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-googlesheets4-1.1.2-r45h785f33e_1.conda + sha256: bd4789b792e6ede77683b6bcc3f2e0c0d2fc61a68d1cb1982b1c9750529a8f9a + md5: 1651a20047fa624b53f168b08396aa57 + depends: + - r-base >=4.5,<4.6.0a0 + - r-cellranger + - r-cli >=3.0.0 + - r-curl + - r-gargle >=1.2.0 + - r-glue >=1.3.0 + - r-googledrive >=2.0.0 + - r-httr + - r-ids + - r-magrittr + - r-purrr + - r-rematch2 + - r-rlang >=0.4.11 + - r-tibble >=2.1.1 + - r-vctrs >=0.2.3 + license: MIT + license_family: MIT + size: 523663 + timestamp: 1758457308165 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-gtable-0.3.6-r45hc72bb7e_1.conda + sha256: fcd2601af8213f39af6f720e22c8f858b3451f8e3d93cbc9e6aedb2d6f88483e + md5: f686123cfba49e6299fae7e029a40266 + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-glue + - r-lifecycle + - r-rlang + license: MIT + license_family: MIT + size: 228864 + timestamp: 1757463478042 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-haven-2.5.5-r45h6d565e7_1.conda + sha256: 1a9c2d371c481819453b13863a50fc9c086851708e2b86f9cd5bc7fa2b3473a4 + md5: c1d0e505a5bc89cfa3b16ba12837ba2b + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - libzlib >=1.3.1,<2.0a0 + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.0.0 + - r-cpp11 + - r-forcats >=0.2.0 + - r-hms + - r-lifecycle + - r-readr >=0.1.0 + - r-rlang >=0.4.0 + - r-tibble + - r-tidyselect + - r-vctrs >=0.3.0 + license: MIT + license_family: MIT + size: 384567 + timestamp: 1757524972098 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-highr-0.12-r45hc72bb7e_0.conda + sha256: e676112aac0dbfe123fcb3108cce376782211a096c898a3af46fdf32a37e12e9 + md5: 0b5902d6af02a23bda1794d46090db42 + depends: + - r-base >=4.5,<4.6.0a0 + - r-xfun >=0.18 + license: GPL-2.0-or-later + license_family: GPL + size: 57308 + timestamp: 1772794436225 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-hms-1.1.4-r45hc72bb7e_0.conda + sha256: be67527b52f98832ab2871d0182fb76499538ca7eb333506084620b7489ce6a0 + md5: 4677c1ad37a9452e27e27d9ed1b8ae90 + depends: + - r-base >=4.5,<4.6.0a0 + - r-ellipsis + - r-lifecycle + - r-pkgconfig + - r-rlang + - r-vctrs >=0.2.1 + license: MIT + license_family: MIT + size: 112799 + timestamp: 1760687922566 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-htmltools-0.5.9-r45h3697838_0.conda + sha256: 1fa1fcdf980d0da17a583e41810da190eb9caf586c3fdf36312d045d9bb812e7 + md5: 2a2297687ae137e7fa90d3c996895e61 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-base64enc + - r-digest + - r-ellipsis + - r-fastmap >=1.1.0 + - r-rlang >=0.4.10 + license: GPL-2.0-or-later + license_family: GPL3 + size: 367095 + timestamp: 1764860550376 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-httr-1.4.8-r45hc72bb7e_0.conda + sha256: 4adb565d2b3365108d7efb926c2acdc68c11ef2ad32ed03d1108a3005cf8cdd8 + md5: 259658089c383f2915b167da3e7890aa + depends: + - r-base >=4.5,<4.6.0a0 + - r-curl >=0.9.1 + - r-jsonlite + - r-mime + - r-openssl >=0.8 + - r-r6 + license: MIT + license_family: MIT + size: 474019 + timestamp: 1771005817336 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-ids-1.0.1-r45hc72bb7e_5.conda + sha256: b14b2cd3ecea0f63c22401a8cdf47171f323ad5859885569a5e8a0922a1c06ea + md5: 94596a1c79c2650346cc208ac5131664 + depends: + - r-base >=4.5,<4.6.0a0 + - r-openssl + - r-uuid + license: MIT + license_family: MIT + size: 129889 + timestamp: 1758407698336 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-irdisplay-1.1-r45hd8ed1ab_4.conda + sha256: df6bf7dc11b49c96a8238459db5e8e883ce8eb4bbcf5497f57fc461cea517b71 + md5: d6ca14e639c018bbdaa60e000c81552c + depends: + - r-base >=4.5,<4.6.0a0 + - r-repr + license: MIT + license_family: MIT + size: 39908 + timestamp: 1757658385868 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-irkernel-1.3.2-r45h785f33e_3.conda + sha256: cc5b45ca05ed61128386b184b365dc4249aed03f5f9ed4f05c8717921b604047 + md5: fdc7ff633754b35b45332d3de541b97a + depends: + - r-base >=4.5,<4.6.0a0 + - r-crayon + - r-digest + - r-evaluate >=0.10 + - r-irdisplay >=0.3.0.9999 + - r-jsonlite >=0.9.6 + - r-pbdzmq >=0.2_1 + - r-repr >=0.4.99 + - r-uuid + license: MIT + license_family: MIT + size: 235173 + timestamp: 1757725332150 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-isoband-0.3.0-r45h3697838_0.conda + sha256: a09a6f2f37890560217117463f0722283f8939af945b3e616b9791f2429325b0 + md5: fb538d0b46d6a44aa1ff666b15422ba6 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-cpp11 + - r-rlang + license: MIT + license_family: MIT + size: 1657523 + timestamp: 1766530500097 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-jquerylib-0.1.4-r45hc72bb7e_4.conda + sha256: 3b98f72bb32d4758854805b664b4404602a583da32c9b96026536f5676f41812 + md5: 49a9ed6ed01f4ae6067ead552795bfce + depends: + - r-base >=4.5,<4.6.0a0 + - r-htmltools + license: MIT + license_family: MIT + size: 307113 + timestamp: 1757459485295 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-jsonlite-2.0.0-r45h54b55ab_1.conda + sha256: bd24c57226192b0decdcddd6fd5fa74db1f29685904e4aff87f2c16eb6493416 + md5: 026c72026f431daf8a5719e09e704faa + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 638574 + timestamp: 1757419590757 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-knitr-1.51-r45hc72bb7e_0.conda + sha256: e2184f1cb58aedacd94d1dbe6e8b5dfa3508151f454e80f6bd49486bdb90625c + md5: 35b31b96aa7bc052ad6347322a1481f1 + depends: + - r-base >=4.5,<4.6.0a0 + - r-evaluate >=0.15 + - r-highr >=0.11 + - r-xfun >=0.52 + - r-yaml >=2.1.19 + license: GPL-2.0-or-later + license_family: GPL + size: 988526 + timestamp: 1766309267127 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-labeling-0.4.3-r45hc72bb7e_2.conda + sha256: 42a06b7c346d6e4550dca1024bbf89e3c22962d568cfe4e8b8be824dea326110 + md5: a41490fdf607381035aa0304c21407c9 + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 70182 + timestamp: 1757456007088 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-lifecycle-1.0.5-r45hc72bb7e_0.conda + sha256: b7a4d8d98a96d17d18c80fb7e1c8e6cb09b9bd2542e74d91a7f483afccb30ee6 + md5: 5f8369dfbdff08878e58bf15529fca3a + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.4.0 + - r-glue + - r-rlang >=1.0.6 + license: MIT + license_family: GPL3 + size: 132636 + timestamp: 1767865665455 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-lubridate-1.9.5-r45h54b55ab_0.conda + sha256: 169ffbb02cd134949c806d521666a5b6fce7d59ea2ca39346c27a13b179a6627 + md5: cec48e713c16eb74b4984019282ad03a + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + - r-generics + - r-timechange >=0.4.0 + license: MIT + license_family: MIT + size: 977124 + timestamp: 1770225935525 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-magrittr-2.0.5-r45h54b55ab_0.conda + sha256: 5b09fdee8ef5426082844d17d360756922ba74f9e3c428f501373295a5e9228d + md5: 2e26e018edc1f198aa72a8f2127fab00 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 211086 + timestamp: 1775298609420 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-memoise-2.0.1-r45hc72bb7e_4.conda + sha256: 91b0eedec5cf5de195b442b97eda508f22fdedbdbc487f74e3868d3e95380fdd + md5: 2b04206ff6ea5a92e8e36bdaa5feb3cc + depends: + - r-base >=4.5,<4.6.0a0 + - r-cachem + - r-rlang >=0.4.10 + license: MIT + license_family: MIT + size: 57750 + timestamp: 1757456335587 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-mime-0.13-r45h54b55ab_1.conda + sha256: 03116d6a8db71492d036c6c052d6cfbf5a98c06da071e42aedb5c740920d6b61 + md5: 26aa2fa52d4caed58336f2b4887916d6 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: GPL-2.0-or-later + license_family: GPL + size: 64912 + timestamp: 1757441376534 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-modelr-0.1.11-r45hc72bb7e_3.conda + sha256: 5e96da0a188a767992ce65e202817d32358e438e6e4e27c9ff023717bc401323 + md5: ccf256de65292fe168b77dc766e0825b + depends: + - r-base >=4.5,<4.6.0a0 + - r-broom + - r-dplyr + - r-magrittr + - r-purrr >=0.2.2 + - r-rlang >=0.2.0 + - r-tibble + - r-tidyr >=0.8.0 + license: GPL-3 + license_family: GPL3 + size: 221251 + timestamp: 1757531745180 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-munsell-0.5.1-r45hc72bb7e_2.conda + sha256: 97d463c2146c483992a25fe497755e9cf714f95ca611a93d8adbb41c068e9e74 + md5: c78bd534986cde8fc0cb08cc9a1a2cc6 + depends: + - r-base >=4.5,<4.6.0a0 + - r-colorspace + license: MIT + license_family: MIT + size: 247241 + timestamp: 1757455926748 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-openssl-2.4.0-r45h68c19f5_0.conda + sha256: 742e6136dec781cebae69d7d34ea4e3364a5f10538b49ad2c688f5687e1ac1ec + md5: fd28e721d19bb124c885cbb4785d4d76 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - openssl >=3.5.6,<4.0a0 + - r-askpass + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 682861 + timestamp: 1776241082358 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-pbdzmq-0.3_14-r45hded8526_1.conda + sha256: 6e2ce549d915ffa2a288938a10097fc9ca0466410f20162a2dbec9876c929890 + md5: 21be627718d6b5b721a51dea34eec375 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - zeromq >=4.3.5,<4.4.0a0 + license: GPL-3.0-only + license_family: GPL3 + size: 530791 + timestamp: 1757662500789 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-pillar-1.11.1-r45hc72bb7e_0.conda + sha256: b3f281041ecff2d4a9f40073ad5e7ec6fa7e0c841068ce85c550bcce0ff8938d + md5: 807ef77a70fc5156f830d6c683d07a29 + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-crayon >=1.3.4 + - r-ellipsis + - r-fansi + - r-lifecycle + - r-rlang >=0.3.0 + - r-utf8 >=1.1.0 + - r-vctrs >=0.2.0 + license: GPL-3.0-only + license_family: GPL3 + size: 629867 + timestamp: 1758149763203 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-pkgconfig-2.0.3-r45hc72bb7e_5.conda + sha256: fda425435a533e86da5f0fc89cf45c9f889a4e6f1e2ed536ca23662a8461602c + md5: 40a5fdd06c7e7880758a021cf2df6c12 + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 27236 + timestamp: 1757447537447 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-prettyunits-1.2.0-r45hc72bb7e_2.conda + sha256: 0306580de6e867b9060595f5eedde4dbf531ee89c16dd3738dde995b30f3fe14 + md5: 07465728b1fd99d28b286156dac895a3 + depends: + - r-assertthat + - r-base >=4.5,<4.6.0a0 + - r-magrittr + license: MIT + license_family: MIT + size: 161043 + timestamp: 1757463130831 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-processx-3.9.0-r45h54b55ab_0.conda + sha256: 7f69cd631f28279b4c706fe2341d8ffbd13cc10ed98e648d0c214ceecce4f877 + md5: c38b8f68cbe321dd5b819d397b2b5061 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + - r-ps >=1.2.0 + - r-r6 + license: MIT + license_family: MIT + size: 411030 + timestamp: 1776865706038 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-progress-1.2.3-r45hc72bb7e_2.conda + sha256: 7dc34860af66a0305601d70714269d8e24766bc9780a43683c1b7989970a61a3 + md5: 619b691b0965c6894eb99d3851857df7 + depends: + - r-base >=4.5,<4.6.0a0 + - r-crayon + - r-hms + - r-prettyunits + - r-r6 + license: MIT + license_family: MIT + size: 96260 + timestamp: 1757484957523 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-ps-1.9.2-r45h54b55ab_0.conda + sha256: 8d4b0256e99a3cf25b7cd755cb3616b8834cf4bfe17d84eb01714d3fb1550d16 + md5: eec32645518b02cb429393c47331bf57 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: BSD-3-Clause + license_family: BSD + size: 411203 + timestamp: 1774994697725 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-purrr-1.2.2-r45h54b55ab_0.conda + sha256: dc5f0ace59844125b92304324000770c7e2e466bab442826cee50a32eef731bf + md5: dc14c484a0415f43dc1b90b518beb41a + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.4 + - r-lifecycle >=1.0.3 + - r-magrittr >=1.5 + - r-rlang >=0.4.10 + - r-vctrs >=0.5 + license: MIT + license_family: MIT + size: 547035 + timestamp: 1775853612539 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-r6-2.6.1-r45hc72bb7e_1.conda + sha256: bd92e91332eba5f0c689583e80adec85ef272c4e0d0b36ee17cb7c11b5693cf2 + md5: 750802806d7d640c286ed8491bb395dc + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 95073 + timestamp: 1757447661037 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-ragg-1.5.2-r45h9f1dc4d_0.conda + sha256: 0e99b7597024257949edd390184fa0ecfd84eea655f192640d1227866b61eb97 + md5: 3bbbc6a7401baca55f71a2811bee0aef + depends: + - __glibc >=2.17,<3.0.a0 + - libfreetype >=2.14.2 + - libfreetype6 >=2.14.2 + - libgcc >=14 + - libjpeg-turbo >=3.1.2,<4.0a0 + - libpng >=1.6.55,<1.7.0a0 + - libstdcxx >=14 + - libtiff >=4.7.1,<4.8.0a0 + - libzlib >=1.3.2,<2.0a0 + - r-base >=4.5,<4.6.0a0 + - r-systemfonts >=1.0.3 + - r-textshaping >=0.3.0 + license: MIT + license_family: MIT + size: 596604 + timestamp: 1774267940113 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-rappdirs-0.3.4-r45h54b55ab_0.conda + sha256: a9778d5fa6777ce286815eb0abef625ff54693532795ef48a1bc319967e0ecb4 + md5: 9fa763ece102dca3e50892bad36896ff + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 54376 + timestamp: 1768747300036 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-rcolorbrewer-1.1_3-r45h785f33e_4.conda + sha256: ddd4e63616ee475bdf9dc63a0b16a89017237121e927d83fbdee07d5a5ccc890 + md5: d8fa238420cb6de47d463b7345a761eb + depends: + - r-base >=4.5,<4.6.0a0 + license: Apache-2.0 + license_family: APACHE + size: 68005 + timestamp: 1757452462302 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-readr-2.2.0-r45h3697838_0.conda + sha256: 06a42932d182259540fd53dca6ac6e988bb28b70d4b09d5786b4260928090598 + md5: a5f0d7d99d912486b2d93a576fadb8e0 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-clipr + - r-cpp11 + - r-crayon + - r-hms >=0.4.1 + - r-lifecycle >=0.2.0 + - r-r6 + - r-rlang + - r-tibble + - r-tzdb >=0.1.1 + - r-vroom >=1.5.4 + license: MIT + license_family: MIT + size: 808559 + timestamp: 1771573588021 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-readxl-1.4.5-r45h10e25cc_1.conda + sha256: 07a22b0e2b77a7c03725c1970d888df1438d35887438ce1becff5bd70b8b9a38 + md5: fcdda2346cffef181c1a5a0aed6a55a3 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libiconv >=1.18,<2.0a0 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-cellranger + - r-cpp11 >=0.4.0 + - r-progress + - r-tibble >=2.0.1 + license: MIT + license_family: MIT + size: 370930 + timestamp: 1757525660693 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-rematch-2.0.0-r45hc72bb7e_2.conda + sha256: ecf7bba5cf082f77c7552a38ea6287e6eeb48cd9c3db878d4e67a3c3a8a9dcfb + md5: 7bf1ee9aab1557eb26fc1cff2d03532a + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 25691 + timestamp: 1757488103455 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-rematch2-2.1.2-r45hc72bb7e_5.conda + sha256: 20ec2130c80ac4b9f5488ea5b1d207b932e99b8a41beae62a58a3fcb98480025 + md5: 9190c3379d369e61841fe1bad6dc91e2 + depends: + - r-base >=4.5,<4.6.0a0 + - r-tibble + license: MIT + license_family: MIT + size: 56155 + timestamp: 1757496154915 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-repr-1.1.7-r45h785f33e_2.conda + sha256: d8229a064695b7a0c36c70b148a76628f180693161bd35a77a9692481794ff37 + md5: 0442a7f2ecc741e142466a7edb5a606f + depends: + - r-base >=4.5,<4.6.0a0 + - r-base64enc + - r-htmltools + - r-jsonlite + - r-pillar >=1.4.0 + license: GPL-3.0-only + license_family: GPL3 + size: 147271 + timestamp: 1757481783597 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-reprex-2.1.1-r45hc72bb7e_2.conda + sha256: d155a7f5b0afb37cb39bad0f156538a9b3d968d656f39ed1cf384d5c3e63aea6 + md5: 8606c6d25de127be0d1d7fa943f828e6 + depends: + - pandoc >=2.0 + - r-base >=4.5,<4.6.0a0 + - r-callr >=3.6.0 + - r-cli >=3.2.0 + - r-clipr >=0.4.0 + - r-fs + - r-glue + - r-knitr >=1.23 + - r-lifecycle + - r-rlang >=1.0.0 + - r-rmarkdown + - r-rstudioapi + - r-withr >=2.3.0 + license: MIT + license_family: MIT + size: 502266 + timestamp: 1757575280578 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-rlang-1.2.0-r45h3697838_0.conda + sha256: d311a9320326f46ec7372aa4944fcbfaa62f9d976dec6be32f3e44f9bc1c720c + md5: f4fb1a80e2e11b92cfc654e9871dc2b7 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + license: GPL-3.0-only + license_family: GPL3 + size: 1590688 + timestamp: 1775483709345 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-rmarkdown-2.31-r45hc72bb7e_0.conda + sha256: b3735a4e75eca023b24678251da041854b94a8b96588d81b605928d6ecf74f11 + md5: 25b9dbf0ff990b8b3111774878e3bb07 + depends: + - pandoc >=1.14 + - r-base >=4.5,<4.6.0a0 + - r-bslib >=0.2.5.1 + - r-evaluate >=0.13 + - r-fontawesome >=0.5.0 + - r-htmltools >=0.5.1 + - r-jquerylib + - r-jsonlite + - r-knitr >=1.43 + - r-tinytex >=0.31 + - r-xfun >=0.36 + - r-yaml >=2.1.19 + license: GPL-3.0-only + license_family: GPL3 + size: 2085382 + timestamp: 1774555006202 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-rstudioapi-0.18.0-r45hc72bb7e_0.conda + sha256: f5a35d4b7dfc17d7ae6eb92210906ccb1fbcc93acacb6d7b392e83bf15702fba + md5: e70e87e097876186fdac23d1a01faede + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 345783 + timestamp: 1768620480911 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-rvest-1.0.5-r45hc72bb7e_1.conda + sha256: 02f66831210485f690a1a1f79dd70f5ba457a3390196d2766ceb0420fac06bc5 + md5: 9f8ec6838bd3fc01ff7f230ca1f924c9 + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-glue + - r-httr >=0.5 + - r-lifecycle >=1.0.0 + - r-magrittr + - r-rlang >=1.0.0 + - r-selectr + - r-tibble + - r-withr + - r-xml2 >=1.3 + license: MIT + license_family: MIT + size: 305178 + timestamp: 1758413050327 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-s7-0.2.2-r45h54b55ab_0.conda + sha256: fae29c4af16617a17fea40c5e484e4350a6fe5d9fad40266f95cf3cb13e7019b + md5: 598ca5290f9be9b22804436295471201 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 311525 + timestamp: 1776861444903 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-sass-0.4.10-r45h3697838_1.conda + sha256: 4d6d7db9d0187a9ede70d6d48278a8ba2b3160e823f5de239b86a6108f23172e + md5: a3ccf52eefa448628535ee758c5a8a37 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-digest + - r-fs + - r-htmltools + - r-r6 + - r-rappdirs + - r-rlang + license: MIT + license_family: MIT + size: 2319704 + timestamp: 1757464682768 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-scales-1.4.0-r45hc72bb7e_1.conda + sha256: 260c384e952e5bd4d2c2de77b9e09b24ff1c1f680acd917c4657ab8c9e4e9a2f + md5: 8bc81cc6fd130cef963bc9e082726a14 + depends: + - r-base >=4.5,<4.6.0a0 + - r-farver >=2.0.0 + - r-labeling + - r-lifecycle + - r-munsell >=0.5 + - r-r6 + - r-rcolorbrewer + - r-viridislite + license: MIT + license_family: MIT + size: 777793 + timestamp: 1757487539496 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-selectr-0.5_1-r45hc72bb7e_0.conda + sha256: d5d4dddd88a5c282c345897bb9faaac4dcc2bca5e63269aec32fa6b21a77bfad + md5: cf2e9902cba2ba0ec9368910a6ae908e + depends: + - r-base >=4.5,<4.6.0a0 + - r-r6 + - r-stringr + license: BSD-3-Clause + license_family: BSD + size: 478871 + timestamp: 1765968903101 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-stringi-1.8.7-r45h3d52c89_2.conda + sha256: 6d0d8d6f1465b3486996edaef7ccd1020cb2fcca1e69b543fc52dbad5262079b + md5: c7ce6f26b92398224c78b92c653b94c1 + depends: + - __glibc >=2.17,<3.0.a0 + - icu >=78.2,<79.0a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + license: FOSS + license_family: OTHER + size: 939928 + timestamp: 1772032511209 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-stringr-1.6.0-r45h785f33e_0.conda + sha256: dea2a7676dd03ed93fa0ec961883c5075c361c8522659a1bc1e6b5c16525cb24 + md5: 8db438d8aa370726ee1ce8bf458f2e6d + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-glue >=1.6.1 + - r-lifecycle >=1.0.3 + - r-magrittr + - r-rlang >=1.0.0 + - r-stringi >=1.5.3 + - r-vctrs + license: MIT + license_family: MIT + size: 319328 + timestamp: 1762269757617 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-sys-3.4.3-r45h54b55ab_1.conda + sha256: 0cf3a7af31b0396d5a2e1c932fffa360472f92a2b373a696f523b0b53ad1d682 + md5: f23bbac61ab0536f59f4caa4c2ebdf88 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 50436 + timestamp: 1757441793835 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-systemfonts-1.3.2-r45h74f4acd_0.conda + sha256: b7c3105c26b006e75a4c770cd4b4cdd88da4153860bb8becac2b1ab068c6aab6 + md5: 7982f08c8aabb6f0e4936a613b07a099 + depends: + - __glibc >=2.17,<3.0.a0 + - libfreetype >=2.14.2 + - libfreetype6 >=2.14.2 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-base64enc + - r-cpp11 >=0.2.1 + - r-jsonlite + - r-lifecycle + license: MIT + license_family: MIT + size: 710089 + timestamp: 1772797917239 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-textshaping-1.0.5-r45h74f4acd_0.conda + sha256: f9dda3386d3ee05a333bbed492deb4c16b5a636b4007410dab21f264f3b5b780 + md5: 58b8dbafb469476a7a7dbffe184910f0 + depends: + - __glibc >=2.17,<3.0.a0 + - fribidi >=1.0.16,<2.0a0 + - harfbuzz >=12.3.2 + - libfreetype >=2.14.2 + - libfreetype6 >=2.14.2 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-cpp11 >=0.2.1 + - r-lifecycle + - r-stringi + - r-systemfonts >=1.3.0 + license: MIT + license_family: MIT + size: 189924 + timestamp: 1772816656813 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-tibble-3.3.1-r45h54b55ab_0.conda + sha256: 256d782fb5773d678f29b88a2c987eb47065e2393a080ca16f400b0256de65bb + md5: ad28f67cbb0b10a5beaa7bf968761cad + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + - r-fansi >=0.4.0 + - r-lifecycle >=1.0.0 + - r-magrittr + - r-pillar >=1.8.1 + - r-pkgconfig + - r-rlang >=1.0.2 + - r-vctrs >=0.4.2 + license: MIT + license_family: MIT + size: 589666 + timestamp: 1768139121744 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-tidyr-1.3.2-r45h3697838_0.conda + sha256: 8c4560d92c1adfce9a37da2f963596a369688b0d5f44d1fa2f0fbfecb486d99f + md5: e571d4d42233dd2aa3bdb0057ffbdc63 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.4.1 + - r-dplyr >=1.0.10 + - r-glue + - r-lifecycle >=1.0.3 + - r-magrittr + - r-purrr >=1.0.1 + - r-rlang >=1.0.4 + - r-stringr >=1.5.0 + - r-tibble >=2.1.1 + - r-tidyselect >=1.2.0 + - r-vctrs >=0.5.2 + license: MIT + license_family: MIT + size: 1127263 + timestamp: 1766142073696 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-tidyselect-1.2.1-r45hc72bb7e_2.conda + sha256: fca09d6b9940f1e1cda0425a0f55716bba202d6f55d6bd25fedec391006c7dc7 + md5: 15aa0f323385403fe182e46a1d095e1b + depends: + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.3.0 + - r-glue >=1.3.0 + - r-lifecycle >=1.0.3 + - r-rlang >=1.0.4 + - r-vctrs >=0.5.2 + - r-withr + license: MIT + license_family: MIT + size: 220192 + timestamp: 1757475791328 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-tidyverse-2.0.0-r45h785f33e_3.conda + sha256: 72940eeb3124b11708443e55f76379453b4973e6bd2b004f50cbd529f0ee504e + md5: 6a2cafa0926645b487c39e1c397ec813 + depends: + - r-base >=4.5,<4.6.0a0 + - r-broom >=1.0.3 + - r-cli >=3.6.0 + - r-conflicted >=1.2.0 + - r-dbplyr >=2.3.0 + - r-dplyr >=1.1.0 + - r-dtplyr >=1.2.2 + - r-forcats >=1.0.0 + - r-ggplot2 >=3.4.1 + - r-googledrive >=2.0.0 + - r-googlesheets4 >=1.0.1 + - r-haven >=2.5.1 + - r-hms >=1.1.2 + - r-httr >=1.4.4 + - r-jsonlite >=1.8.4 + - r-lubridate >=1.9.2 + - r-magrittr >=2.0.3 + - r-modelr >=0.1.10 + - r-pillar >=1.8.1 + - r-purrr >=1.0.1 + - r-ragg >=1.2.5 + - r-readr >=2.1.4 + - r-readxl >=1.4.2 + - r-reprex >=2.0.2 + - r-rlang >=1.0.6 + - r-rstudioapi >=0.14 + - r-rvest >=1.0.3 + - r-stringr >=1.5.0 + - r-tibble >=3.1.8 + - r-tidyr >=1.3.0 + - r-xml2 >=1.3.3 + license: MIT + license_family: MIT + size: 427253 + timestamp: 1758467348888 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-timechange-0.4.0-r45h3697838_0.conda + sha256: 47d03f8df0b40173e41a5b0a8d0318b0a274a5302d67aadad7e4769bad1b2509 + md5: 77b6b03b30183b189906b08ea0868b21 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-cpp11 >=0.2.7 + license: GPL-3.0-only AND Apache-2.0 + license_family: GPL3 + size: 193829 + timestamp: 1769737645751 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-tinytex-0.59-r45hc72bb7e_0.conda + sha256: cabc58da08c6398846a9150447bef28da09ea440e10d4dcf39e46cbb26424848 + md5: 23e96bde077293a06d1f16ca1d33e009 + depends: + - r-base >=4.5,<4.6.0a0 + - r-xfun >=0.5 + license: MIT + license_family: MIT + size: 157337 + timestamp: 1774815071643 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-tzdb-0.5.0-r45h3697838_2.conda + sha256: d5e6baaf4063a7fb2c462e6f1a5ffda1c8928eb4b943887e4989e8eac9a98916 + md5: 54673c8b5186c85794f0bd40d7c49bb4 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-cpp11 >=0.5.2 + license: MIT + license_family: MIT + size: 555420 + timestamp: 1757490039639 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-utf8-1.2.6-r45h54b55ab_1.conda + sha256: 97186abdf7c29872e012c9fe05ec16c019b58c43ac7b778baa480a8acae9c914 + md5: 75cb2540ac930ea879e92d99e00e97c3 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: Apache-2.0 + license_family: APACHE + size: 147244 + timestamp: 1757424673681 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-uuid-1.2_2-r45h54b55ab_0.conda + sha256: 8c58a2b7a3ee7f4369c9216bdc3d8a3ffe56f74e0bcc77c3353911f90b7844a1 + md5: 5c4bebb58545f26f41934325844bda70 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 57588 + timestamp: 1769224723187 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-vctrs-0.7.3-r45h3697838_0.conda + sha256: 73b0cdea9f85496b80e75ffa20f94aa4ab746f4b7af566742e22381bffa6772d + md5: 372cefc1b05a567d1fbe19633766ab0c + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-cli >=3.4.0 + - r-glue + - r-lifecycle >=1.0.3 + - r-rlang >=1.0.6 + license: MIT + license_family: MIT + size: 1805012 + timestamp: 1775897999712 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-viridislite-0.4.3-r45hc72bb7e_0.conda + sha256: b9ec9606562f0f6bdefc237bbc6163eb1cb022f9d699c80771bc84af0ae37269 + md5: bcadc0a3726e2191e51449f67fa5e0a9 + depends: + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 1305542 + timestamp: 1770191459321 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-vroom-1.7.1-r45h3697838_0.conda + sha256: c322b1115a9e066505deb292ab38c76ad9d2a983c8269c82e89229dbf6bf5494 + md5: 8e45deb7cb8502dda9073be1a5e664df + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + - r-bit64 + - r-cli + - r-cpp11 >=0.2.0 + - r-crayon + - r-glue + - r-hms + - r-lifecycle + - r-progress >=1.2.1 + - r-rlang >=0.4.2 + - r-tibble >=2.0.0 + - r-tidyselect + - r-tzdb >=0.1.1 + - r-vctrs >=0.2.0 + - r-withr + license: MIT + license_family: MIT + size: 934319 + timestamp: 1774940641597 +- conda: https://conda.anaconda.org/conda-forge/noarch/r-withr-3.0.2-r45hc72bb7e_1.conda + sha256: ce2d02905f29ae7e9e18a44d1985896628f6bb1ae6348a67e9534d5b8779485b + md5: 56c45a76870f89e39aeca8ba4d4e911a + depends: + - r-base >=4.5,<4.6.0a0 + license: GPL-2.0-or-later + license_family: GPL2 + size: 235156 + timestamp: 1757447242401 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-xfun-0.57-r45h3697838_0.conda + sha256: 29e388ad6532d694f84407f97adb1043ef2d92c25b01affaeed19a6487ad4cba + md5: 5016c4e6a78579e1fd3156d2894b474f + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libstdcxx >=14 + - r-base >=4.5,<4.6.0a0 + license: MIT + license_family: MIT + size: 597036 + timestamp: 1774807163423 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-xml2-1.5.2-r45he78afff_0.conda + sha256: f847cc5166f814ec9c35c28bd6abc20879750fe2b658e4503505fce78951df75 + md5: d7feead194c1df2c74bd11e37acc9573 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - liblzma >=5.8.2,<6.0a0 + - libstdcxx >=14 + - libxml2 + - libxml2-16 >=2.14.6 + - libzlib >=1.3.1,<2.0a0 + - r-base >=4.5,<4.6.0a0 + - r-cli + - r-rlang >=1.1.0 + license: GPL-2.0-or-later + license_family: GPL2 + size: 354820 + timestamp: 1768764934482 +- conda: https://conda.anaconda.org/conda-forge/linux-64/r-yaml-2.3.12-r45h54b55ab_0.conda + sha256: f8944d47eccfdb2c04e27fd65797de7468ccc5d9f3fc3d9af296da613d75d79c + md5: d0d07c6f14b640a98cf6a5e3e4e2e723 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - r-base >=4.5,<4.6.0a0 + license: BSD-3-Clause + license_family: BSD + size: 124461 + timestamp: 1765372968808 +- conda: https://conda.anaconda.org/conda-forge/linux-64/readline-8.3-h853b02a_0.conda + sha256: 12ffde5a6f958e285aa22c191ca01bbd3d6e710aa852e00618fa6ddc59149002 + md5: d7d95fc8287ea7bf33e0e7116d2b95ec depends: - - ptyprocess >=0.5 - - python >=3.9 - license: ISC - size: 53561 - timestamp: 1733302019362 -- conda: https://conda.anaconda.org/conda-forge/noarch/platformdirs-4.9.6-pyhcf101f3_0.conda - sha256: 8f29915c172f1f7f4f7c9391cd5dac3ebf5d13745c8b7c8006032615246345a5 - md5: 89c0b6d1793601a2a3a3f7d2d3d8b937 + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - ncurses >=6.5,<7.0a0 + license: GPL-3.0-only + license_family: GPL + size: 345073 + timestamp: 1765813471974 +- conda: https://conda.anaconda.org/conda-forge/noarch/referencing-0.37.0-pyhcf101f3_0.conda + sha256: 0577eedfb347ff94d0f2fa6c052c502989b028216996b45c7f21236f25864414 + md5: 870293df500ca7e18bedefa5838a22ab depends: + - attrs >=22.2.0 - python >=3.10 + - rpds-py >=0.7.0 + - typing_extensions >=4.4.0 - python license: MIT license_family: MIT - size: 25862 - timestamp: 1775741140609 -- conda: https://conda.anaconda.org/conda-forge/noarch/prompt-toolkit-3.0.52-pyha770c72_0.conda - sha256: 4817651a276016f3838957bfdf963386438c70761e9faec7749d411635979bae - md5: edb16f14d920fb3faf17f5ce582942d6 + size: 51788 + timestamp: 1760379115194 +- conda: https://conda.anaconda.org/conda-forge/noarch/requests-2.33.1-pyhcf101f3_1.conda + sha256: 7f2c24dd3bd3c104a1d2c9a10ead5ed6758b0976b74f972cfe9c19884ccc4241 + md5: 9659f587a8ceacc21864260acd02fc67 depends: - python >=3.10 - - wcwidth + - certifi >=2023.5.7 + - charset-normalizer >=2,<4 + - idna >=2.5,<4 + - urllib3 >=1.26,<3 + - python constrains: - - prompt_toolkit 3.0.52 - license: BSD-3-Clause - license_family: BSD - size: 273927 - timestamp: 1756321848365 -- conda: https://conda.anaconda.org/conda-forge/noarch/ptyprocess-0.7.0-pyhd8ed1ab_1.conda - sha256: a7713dfe30faf17508ec359e0bc7e0983f5d94682492469bd462cdaae9c64d83 - md5: 7d9daffbb8d8e0af0f769dbbcd173a54 + - chardet >=3.0.2,<8 + license: Apache-2.0 + size: 63728 + timestamp: 1777030058920 +- conda: https://conda.anaconda.org/conda-forge/noarch/rfc3339-validator-0.1.4-pyhd8ed1ab_1.conda + sha256: 2e4372f600490a6e0b3bac60717278448e323cab1c0fecd5f43f7c56535a99c5 + md5: 36de09a8d3e5d5e6f4ee63af49e59706 depends: - python >=3.9 - license: ISC - size: 19457 - timestamp: 1733302371990 -- conda: https://conda.anaconda.org/conda-forge/noarch/pure_eval-0.2.3-pyhd8ed1ab_1.conda - sha256: 71bd24600d14bb171a6321d523486f6a06f855e75e547fa0cb2a0953b02047f0 - md5: 3bfdfb8dbcdc4af1ae3f9a8eb3948f04 + - six + license: MIT + license_family: MIT + size: 10209 + timestamp: 1733600040800 +- conda: https://conda.anaconda.org/conda-forge/noarch/rfc3986-validator-0.1.1-pyh9f0ad1d_0.tar.bz2 + sha256: 2a5b495a1de0f60f24d8a74578ebc23b24aa53279b1ad583755f223097c41c37 + md5: 912a71cc01012ee38e6b90ddd561e36f depends: - - python >=3.9 + - python license: MIT license_family: MIT - size: 16668 - timestamp: 1733569518868 -- conda: https://conda.anaconda.org/conda-forge/noarch/pycodestyle-2.14.0-pyhd8ed1ab_0.conda - sha256: 1950f71ff44e64163e176b1ca34812afc1a104075c3190de50597e1623eb7d53 - md5: 85815c6a22905c080111ec8d56741454 + size: 7818 + timestamp: 1598024297745 +- conda: https://conda.anaconda.org/conda-forge/noarch/rfc3987-syntax-1.1.0-pyhe01879c_1.conda + sha256: 70001ac24ee62058557783d9c5a7bbcfd97bd4911ef5440e3f7a576f9e43bc92 + md5: 7234f99325263a5af6d4cd195035e8f2 depends: - python >=3.9 + - lark >=1.2.2 + - python license: MIT license_family: MIT - size: 35182 - timestamp: 1750616054854 -- conda: https://conda.anaconda.org/conda-forge/noarch/pygments-2.20.0-pyhd8ed1ab_0.conda - sha256: cf70b2f5ad9ae472b71235e5c8a736c9316df3705746de419b59d442e8348e86 - md5: 16c18772b340887160c79a6acc022db0 - depends: - - python >=3.10 - license: BSD-2-Clause - license_family: BSD - size: 893031 - timestamp: 1774796815820 -- conda: https://conda.anaconda.org/conda-forge/linux-64/python-3.13.13-h6add32d_100_cp313.conda - build_number: 100 - sha256: 7f77eb57648f545c1f58e10035d0d9d66b0a0efb7c4b58d3ed89ec7269afdde1 - md5: 05051be49267378d2fcd12931e319ac3 - depends: - - __glibc >=2.17,<3.0.a0 - - bzip2 >=1.0.8,<2.0a0 - - ld_impl_linux-64 >=2.36.1 - - libexpat >=2.7.5,<3.0a0 - - libffi >=3.5.2,<3.6.0a0 - - libgcc >=14 - - liblzma >=5.8.2,<6.0a0 - - libmpdec >=4.0.0,<5.0a0 - - libsqlite >=3.52.0,<4.0a0 - - libuuid >=2.42,<3.0a0 - - libzlib >=1.3.2,<2.0a0 - - ncurses >=6.5,<7.0a0 - - openssl >=3.5.6,<4.0a0 - - python_abi 3.13.* *_cp313 - - readline >=8.3,<9.0a0 - - tk >=8.6.13,<8.7.0a0 - - tzdata - license: Python-2.0 - size: 37358322 - timestamp: 1775614712638 - python_site_packages_path: lib/python3.13/site-packages -- conda: https://conda.anaconda.org/conda-forge/noarch/python_abi-3.13-8_cp313.conda - build_number: 8 - sha256: 210bffe7b121e651419cb196a2a63687b087497595c9be9d20ebe97dd06060a7 - md5: 94305520c52a4aa3f6c2b1ff6008d9f8 - constrains: - - python 3.13.* *_cp313 - license: BSD-3-Clause - license_family: BSD - size: 7002 - timestamp: 1752805902938 -- conda: https://conda.anaconda.org/conda-forge/linux-64/pytokens-0.4.1-py313h54dd161_1.conda - sha256: 543302099bbe6b2e77e8a43894dc3894a0bf47e18ea1b0b21ade196f0bdf1ce7 - md5: 8aafbc11caed472c9f7a174f9925fb94 + size: 22913 + timestamp: 1752876729969 +- conda: https://conda.anaconda.org/conda-forge/linux-64/rpds-py-0.30.0-py313h843e2db_0.conda + sha256: 076d26e51c62c8ecfca6eb19e3c1febdd7632df1990a7aa53da5df5e54482b1c + md5: 779e3307a0299518713765b83a36f4b1 depends: - python - libgcc >=14 - __glibc >=2.17,<3.0.a0 - python_abi 3.13.* *_cp313 + constrains: + - __glibc >=2.17 license: MIT license_family: MIT - size: 277555 - timestamp: 1771613648731 -- conda: https://conda.anaconda.org/conda-forge/linux-64/readline-8.3-h853b02a_0.conda - sha256: 12ffde5a6f958e285aa22c191ca01bbd3d6e710aa852e00618fa6ddc59149002 - md5: d7d95fc8287ea7bf33e0e7116d2b95ec + size: 383230 + timestamp: 1764543223529 +- conda: https://conda.anaconda.org/conda-forge/linux-64/sed-4.10-h19d0853_0.conda + sha256: b013d2085ce4ac01daec7b30472e9f3b6c2d69eb3a3a85a6cee3e01a3cb4f61a + md5: e4a1ff2e59a5d9b38be71d15c93cf1bd depends: - __glibc >=2.17,<3.0.a0 - libgcc >=14 - - ncurses >=6.5,<7.0a0 license: GPL-3.0-only - license_family: GPL - size: 345073 - timestamp: 1765813471974 + size: 268482 + timestamp: 1776859422619 +- conda: https://conda.anaconda.org/conda-forge/noarch/send2trash-2.1.0-pyha191276_1.conda + sha256: 59656f6b2db07229351dfb3a859c35e57cc8e8bcbc86d4e501bff881a6f771f1 + md5: 28eb91468df04f655a57bcfbb35fc5c5 + depends: + - __linux + - python >=3.10 + - python + license: BSD-3-Clause + license_family: BSD + size: 24108 + timestamp: 1770937597662 +- conda: https://conda.anaconda.org/conda-forge/noarch/setuptools-82.0.1-pyh332efcf_0.conda + sha256: 82088a6e4daa33329a30bc26dc19a98c7c1d3f05c0f73ce9845d4eab4924e9e1 + md5: 8e194e7b992f99a5015edbd4ebd38efd + depends: + - python >=3.10 + license: MIT + license_family: MIT + size: 639697 + timestamp: 1773074868565 +- conda: https://conda.anaconda.org/conda-forge/noarch/six-1.17.0-pyhe01879c_1.conda + sha256: 458227f759d5e3fcec5d9b7acce54e10c9e1f4f4b7ec978f3bfd54ce4ee9853d + md5: 3339e3b65d58accf4ca4fb8748ab16b3 + depends: + - python >=3.9 + - python + license: MIT + license_family: MIT + size: 18455 + timestamp: 1753199211006 +- conda: https://conda.anaconda.org/conda-forge/noarch/sniffio-1.3.1-pyhd8ed1ab_2.conda + sha256: dce518f45e24cd03f401cb0616917773159a210c19d601c5f2d4e0e5879d30ad + md5: 03fe290994c5e4ec17293cfb6bdce520 + depends: + - python >=3.10 + license: Apache-2.0 + license_family: Apache + size: 15698 + timestamp: 1762941572482 +- conda: https://conda.anaconda.org/conda-forge/noarch/soupsieve-2.8.3-pyhd8ed1ab_0.conda + sha256: 23b71ecf089967d2900126920e7f9ff18cdcef82dbff3e2f54ffa360243a17ac + md5: 18de09b20462742fe093ba39185d9bac + depends: + - python >=3.10 + license: MIT + license_family: MIT + size: 38187 + timestamp: 1769034509657 - conda: https://conda.anaconda.org/conda-forge/noarch/stack_data-0.6.3-pyhd8ed1ab_1.conda sha256: 570da295d421661af487f1595045760526964f41471021056e993e73089e9c41 md5: b1b505328da7a6b246787df4b5a49fbc @@ -561,6 +4251,40 @@ packages: license_family: MIT size: 26988 timestamp: 1733569565672 +- conda: https://conda.anaconda.org/conda-forge/noarch/sysroot_linux-64-2.28-h4ee821c_9.conda + sha256: c47299fe37aebb0fcf674b3be588e67e4afb86225be4b0d452c7eb75c086b851 + md5: 13dc3adbc692664cd3beabd216434749 + depends: + - __glibc >=2.28 + - kernel-headers_linux-64 4.18.0 he073ed8_9 + - tzdata + license: LGPL-2.0-or-later AND LGPL-2.0-or-later WITH exceptions AND GPL-2.0-or-later + license_family: GPL + size: 24008591 + timestamp: 1765578833462 +- conda: https://conda.anaconda.org/conda-forge/noarch/terminado-0.18.1-pyhc90fa1f_1.conda + sha256: 6b6727a13d1ca6a23de5e6686500d0669081a117736a87c8abf444d60c1e40eb + md5: 17b43cee5cc84969529d5d0b0309b2cb + depends: + - __unix + - ptyprocess + - python >=3.10 + - tornado >=6.1.0 + - python + license: BSD-2-Clause + license_family: BSD + size: 24749 + timestamp: 1766513766867 +- conda: https://conda.anaconda.org/conda-forge/noarch/tinycss2-1.4.0-pyhd8ed1ab_0.conda + sha256: cad582d6f978276522f84bd209a5ddac824742fe2d452af6acf900f8650a73a2 + md5: f1acf5fdefa8300de697982bcb1761c9 + depends: + - python >=3.5 + - webencodings >=0.4 + license: BSD-3-Clause + license_family: BSD + size: 28285 + timestamp: 1729802975370 - conda: https://conda.anaconda.org/conda-forge/linux-64/tk-8.6.13-noxft_h366c992_103.conda sha256: cafeec44494f842ffeca27e9c8b0c27ed714f93ac77ddadc6aaf726b5554ebac md5: cffd3bdd58090148f4cfcd831f4b26ab @@ -574,6 +4298,18 @@ packages: license_family: BSD size: 3301196 timestamp: 1769460227866 +- conda: https://conda.anaconda.org/conda-forge/linux-64/tktable-2.10-h5a7a40f_8.conda + sha256: 3e20b2f2902a1f402ef2420ce2b9e8c91f9e02748d55530894ac1f640561fdd0 + md5: 72628f56d7a99b86efa435a0b97a4b47 + depends: + - tk + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - tk >=8.6.13,<8.7.0a0 + - xorg-libx11 >=1.8.13,<2.0a0 + license: TCL + size: 102544 + timestamp: 1773732786017 - conda: https://conda.anaconda.org/conda-forge/noarch/tokenize-rt-6.2.0-pyhd8ed1ab_0.conda sha256: b8da0c728e1313e116a06084ea770c6ad752b9cd086d52b20fcd464bdce52e4b md5: 0a42378794e0425eb5defc9d63e60607 @@ -593,6 +4329,18 @@ packages: license_family: MIT size: 21561 timestamp: 1774492402955 +- conda: https://conda.anaconda.org/conda-forge/linux-64/tornado-6.5.5-py313h07c4f96_0.conda + sha256: 9e8497e1ecca77d03c6be2d3b5f901dfe0ab99686af4fb94ab418b7d449ac547 + md5: 6c0b0ae017b5bfd9c8d718217efd8f14 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - python >=3.13,<3.14.0a0 + - python_abi 3.13.* *_cp313 + license: Apache-2.0 + license_family: Apache + size: 882996 + timestamp: 1774358035145 - conda: https://conda.anaconda.org/conda-forge/noarch/traitlets-5.14.3-pyhd8ed1ab_1.conda sha256: f39a5620c6e8e9e98357507262a7869de2ae8cc07da8b7f84e517c9fd6c2b959 md5: 019a7385be9af33791c989871317e1ed @@ -602,12 +4350,62 @@ packages: license_family: BSD size: 110051 timestamp: 1733367480074 +- conda: https://conda.anaconda.org/conda-forge/noarch/typing-extensions-4.15.0-h396c80c_0.conda + sha256: 7c2df5721c742c2a47b2c8f960e718c930031663ac1174da67c1ed5999f7938c + md5: edd329d7d3a4ab45dcf905899a7a6115 + depends: + - typing_extensions ==4.15.0 pyhcf101f3_0 + license: PSF-2.0 + license_family: PSF + size: 91383 + timestamp: 1756220668932 +- conda: https://conda.anaconda.org/conda-forge/noarch/typing_extensions-4.15.0-pyhcf101f3_0.conda + sha256: 032271135bca55aeb156cee361c81350c6f3fb203f57d024d7e5a1fc9ef18731 + md5: 0caa1af407ecff61170c9437a808404d + depends: + - python >=3.10 + - python + license: PSF-2.0 + license_family: PSF + size: 51692 + timestamp: 1756220668932 +- conda: https://conda.anaconda.org/conda-forge/noarch/typing_utils-0.1.0-pyhd8ed1ab_1.conda + sha256: 3088d5d873411a56bf988eee774559335749aed6f6c28e07bf933256afb9eb6c + md5: f6d7aa696c67756a650e91e15e88223c + depends: + - python >=3.9 + license: Apache-2.0 + license_family: APACHE + size: 15183 + timestamp: 1733331395943 - conda: https://conda.anaconda.org/conda-forge/noarch/tzdata-2025c-hc9c84f9_1.conda sha256: 1d30098909076af33a35017eed6f2953af1c769e273a0626a04722ac4acaba3c md5: ad659d0a2b3e47e38d829aa8cad2d610 license: LicenseRef-Public-Domain size: 119135 timestamp: 1767016325805 +- conda: https://conda.anaconda.org/conda-forge/noarch/uri-template-1.3.0-pyhd8ed1ab_1.conda + sha256: e0eb6c8daf892b3056f08416a96d68b0a358b7c46b99c8a50481b22631a4dfc0 + md5: e7cb0f5745e4c5035a460248334af7eb + depends: + - python >=3.9 + license: MIT + license_family: MIT + size: 23990 + timestamp: 1733323714454 +- conda: https://conda.anaconda.org/conda-forge/noarch/urllib3-2.6.3-pyhd8ed1ab_0.conda + sha256: af641ca7ab0c64525a96fd9ad3081b0f5bcf5d1cbb091afb3f6ed5a9eee6111a + md5: 9272daa869e03efe68833e3dc7a02130 + depends: + - backports.zstd >=1.0.0 + - brotli-python >=1.2.0 + - h2 >=4,<5 + - pysocks >=1.5.6,<2.0,!=1.5.7 + - python >=3.10 + license: MIT + license_family: MIT + size: 103172 + timestamp: 1767817860341 - conda: https://conda.anaconda.org/conda-forge/noarch/wcwidth-0.6.0-pyhd8ed1ab_0.conda sha256: e298b508b2473c4227206800dfb14c39e4b14fd79d4636132e9e1e4244cdf4aa md5: c3197f8c0d5b955c904616b716aca093 @@ -617,6 +4415,153 @@ packages: license_family: MIT size: 71550 timestamp: 1770634638503 +- conda: https://conda.anaconda.org/conda-forge/noarch/webcolors-25.10.0-pyhd8ed1ab_0.conda + sha256: 21f6c8a20fe050d09bfda3fb0a9c3493936ce7d6e1b3b5f8b01319ee46d6c6f6 + md5: 6639b6b0d8b5a284f027a2003669aa65 + depends: + - python >=3.10 + license: BSD-3-Clause + license_family: BSD + size: 18987 + timestamp: 1761899393153 +- conda: https://conda.anaconda.org/conda-forge/noarch/webencodings-0.5.1-pyhd8ed1ab_3.conda + sha256: 19ff205e138bb056a46f9e3839935a2e60bd1cf01c8241a5e172a422fed4f9c6 + md5: 2841eb5bfc75ce15e9a0054b98dcd64d + depends: + - python >=3.9 + license: BSD-3-Clause + license_family: BSD + size: 15496 + timestamp: 1733236131358 +- conda: https://conda.anaconda.org/conda-forge/noarch/websocket-client-1.9.0-pyhd8ed1ab_0.conda + sha256: 42a2b61e393e61cdf75ced1f5f324a64af25f347d16c60b14117393a98656397 + md5: 2f1ed718fcd829c184a6d4f0f2e07409 + depends: + - python >=3.10 + license: Apache-2.0 + license_family: APACHE + size: 61391 + timestamp: 1759928175142 +- conda: https://conda.anaconda.org/conda-forge/noarch/widgetsnbextension-4.0.15-pyhd8ed1ab_0.conda + sha256: 826af5e2c09e5e45361fa19168f46ff524e7a766022615678c3a670c45895d9a + md5: dc257b7e7cad9b79c1dfba194e92297b + depends: + - python >=3.10 + license: BSD-3-Clause + license_family: BSD + size: 889195 + timestamp: 1762040404362 +- conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libice-1.1.2-hb9d3cd8_0.conda + sha256: c12396aabb21244c212e488bbdc4abcdef0b7404b15761d9329f5a4a39113c4b + md5: fb901ff28063514abb6046c9ec2c4a45 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + license: MIT + license_family: MIT + size: 58628 + timestamp: 1734227592886 +- conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libsm-1.2.6-he73a12e_0.conda + sha256: 277841c43a39f738927145930ff963c5ce4c4dacf66637a3d95d802a64173250 + md5: 1c74ff8c35dcadf952a16f752ca5aa49 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + - libuuid >=2.38.1,<3.0a0 + - xorg-libice >=1.1.2,<2.0a0 + license: MIT + license_family: MIT + size: 27590 + timestamp: 1741896361728 +- conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libx11-1.8.13-he1eb515_0.conda + sha256: 516d4060139dbb4de49a4dcdc6317a9353fb39ebd47789c14e6fe52de0deee42 + md5: 861fb6ccbc677bb9a9fb2468430b9c6a + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - libxcb >=1.17.0,<2.0a0 + license: MIT + license_family: MIT + size: 839652 + timestamp: 1770819209719 +- conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxau-1.0.12-hb03c661_1.conda + sha256: 6bc6ab7a90a5d8ac94c7e300cc10beb0500eeba4b99822768ca2f2ef356f731b + md5: b2895afaf55bf96a8c8282a2e47a5de0 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + license: MIT + license_family: MIT + size: 15321 + timestamp: 1762976464266 +- conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxdmcp-1.1.5-hb03c661_1.conda + sha256: 25d255fb2eef929d21ff660a0c687d38a6d2ccfbcbf0cc6aa738b12af6e9d142 + md5: 1dafce8548e38671bea82e3f5c6ce22f + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + license: MIT + license_family: MIT + size: 20591 + timestamp: 1762976546182 +- conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxext-1.3.7-hb03c661_0.conda + sha256: 79c60fc6acfd3d713d6340d3b4e296836a0f8c51602327b32794625826bd052f + md5: 34e54f03dfea3e7a2dcf1453a85f1085 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=14 + - xorg-libx11 >=1.8.12,<2.0a0 + license: MIT + license_family: MIT + size: 50326 + timestamp: 1769445253162 +- conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxrender-0.9.12-hb9d3cd8_0.conda + sha256: 044c7b3153c224c6cedd4484dd91b389d2d7fd9c776ad0f4a34f099b3389f4a1 + md5: 96d57aba173e878a2089d5638016dc5e + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + - xorg-libx11 >=1.8.10,<2.0a0 + license: MIT + license_family: MIT + size: 33005 + timestamp: 1734229037766 +- conda: https://conda.anaconda.org/conda-forge/linux-64/xorg-libxt-1.3.1-hb9d3cd8_0.conda + sha256: a8afba4a55b7b530eb5c8ad89737d60d60bc151a03fbef7a2182461256953f0e + md5: 279b0de5f6ba95457190a1c459a64e31 + depends: + - __glibc >=2.17,<3.0.a0 + - libgcc >=13 + - xorg-libice >=1.1.1,<2.0a0 + - xorg-libsm >=1.2.4,<2.0a0 + - xorg-libx11 >=1.8.10,<2.0a0 + license: MIT + license_family: MIT + size: 379686 + timestamp: 1731860547604 +- conda: https://conda.anaconda.org/conda-forge/linux-64/yaml-0.2.5-h280c20c_3.conda + sha256: 6d9ea2f731e284e9316d95fa61869fe7bbba33df7929f82693c121022810f4ad + md5: a77f85f77be52ff59391544bfe73390a + depends: + - libgcc >=14 + - __glibc >=2.17,<3.0.a0 + license: MIT + license_family: MIT + size: 85189 + timestamp: 1753484064210 +- conda: https://conda.anaconda.org/conda-forge/linux-64/zeromq-4.3.5-h41580af_10.conda + sha256: 325d370b28e2b9cc1f765c5b4cdb394c91a5d958fbd15da1a14607a28fee09f6 + md5: 755b096086851e1193f3b10347415d7c + depends: + - libgcc >=14 + - __glibc >=2.17,<3.0.a0 + - libstdcxx >=14 + - krb5 >=1.22.2,<1.23.0a0 + - libsodium >=1.0.21,<1.0.22.0a0 + license: MPL-2.0 + license_family: MOZILLA + size: 311150 + timestamp: 1772476812121 - conda: https://conda.anaconda.org/conda-forge/noarch/zipp-3.23.1-pyhcf101f3_0.conda sha256: 523616c0530d305d2216c2b4a8dfd3872628b60083255b89c5e0d8c42e738cca md5: e1c36c6121a7c9c76f2f148f1e83b983 diff --git a/pixi.toml b/pixi.toml index dd6afc9..f79b5e3 100644 --- a/pixi.toml +++ b/pixi.toml @@ -12,3 +12,9 @@ check-nbs = { cmd = ["bash", "-lc", "find . -name '*.ipynb' -exec nbqa black --c [dependencies] nbqa = ">=1.9.0,<2" black = ">=26.3.1,<27" +r-irkernel = ">=1.3.2,<2" +r-tidyverse = ">=2.0.0,<3" +jupyter = ">=1.1.1,<2" +pandas = ">=3.0.2,<4" +numpy = ">=2.4.3,<3" +python = "==3.13.13" diff --git a/solutions/solutions_08.ipynb b/solutions/solutions_08.ipynb index 9c2cf25..2fbbcbb 100644 --- a/solutions/solutions_08.ipynb +++ b/solutions/solutions_08.ipynb @@ -1,23 +1,5 @@ { "cells": [ - { - "cell_type": "code", - "execution_count": null, - "id": "f6b812a0", - "metadata": {}, - "outputs": [], - "source": [ - "(\n", - " ggplot(df_mean, aes(\"group\", \"mean_y\", fill=\"group\"))\n", - " + geom_col(width=0.7)\n", - " + coord_flip()\n", - " + scale_fill_brewer(type=\"qual\", palette=\"Set2\")\n", - " + labs(title=\"Mean y by group (horizontal)\", x=\"group\", y=\"mean(y)\")\n", - " + theme_minimal()\n", - " + theme(legend_position=\"none\")\n", - ")" - ] - }, { "cell_type": "markdown", "id": "ecee966f", diff --git a/solutions/solutions_09.ipynb b/solutions/solutions_09.ipynb new file mode 100644 index 0000000..e7d409a --- /dev/null +++ b/solutions/solutions_09.ipynb @@ -0,0 +1,149 @@ +{ + "cells": [ + { + "cell_type": "markdown", + "id": "a60ff099", + "metadata": {}, + "source": [ + "# Lesson 09" + ] + }, + { + "cell_type": "markdown", + "id": "71ed706c", + "metadata": {}, + "source": [ + "\n", + "## Exercises\n", + "\n", + "\n", + "- compute mean and standard deviation of the following numeric vector\n", + "- note: use `mean()` and `sd()` functions, and handle missing values" + ] + }, + { + "cell_type": "code", + "execution_count": 3, + "id": "f3ddcbac", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [ + { + "data": { + "text/html": [ + "14" + ], + "text/latex": [ + "14" + ], + "text/markdown": [ + "14" + ], + "text/plain": [ + "[1] 14" + ] + }, + "metadata": {}, + "output_type": "display_data" + }, + { + "data": { + "text/html": [ + "12.0968315410827" + ], + "text/latex": [ + "12.0968315410827" + ], + "text/markdown": [ + "12.0968315410827" + ], + "text/plain": [ + "[1] 12.09683" + ] + }, + "metadata": {}, + "output_type": "display_data" + } + ], + "source": [ + "my_vec = c(3, 6, 12, 34, 2, 15, 26, NA)\n", + "\n", + "mean(my_vec,na.rm = TRUE)\n", + "sd(my_vec,na.rm = TRUE)\n" + ] + }, + { + "cell_type": "markdown", + "id": "82880baa", + "metadata": {}, + "source": [ + "- you get the following data frame with gene expression values for 3 genes across 4 samples\n", + "- calculate the mean expression of treatment and control for each gene separately\n", + "- use a function and a for-loop\n", + "- NOTE 1: this data frame is already in the convenient **long format** where all observations are spread on individual rows, not columns\n", + "- NOTE 2: there are *much more efficient* ways to achieve this in R that we will learn about next lesson" + ] + }, + { + "cell_type": "code", + "execution_count": 4, + "id": "c9191d86", + "metadata": { + "vscode": { + "languageId": "r" + } + }, + "outputs": [ + { + "name": "stdout", + "output_type": "stream", + "text": [ + "[1] \"tetR , treatment: 20 , control: 17.5\"\n", + "[1] \"tetA , treatment: 18.5 , control: 22\"\n", + "[1] \"tetB , treatment: 28 , control: 24\"\n" + ] + } + ], + "source": [ + "df <- data.frame(\n", + " gene = rep(c(\"tetR\", \"tetA\", \"tetB\"), each = 4),\n", + " condition = rep(c(\"treatment\", \"control\"), times = 6),\n", + " replicate = rep(c(1, 1, 2, 2), times = 3),\n", + " expression = c(10, 20, 30, 15, 25, NA, 12, 22, 32, 14, 24, 34)\n", + ")\n", + "\n", + "robust_mean <- function(x) {\n", + " mean(x, na.rm = TRUE)\n", + "}\n", + "\n", + "for (g in unique(df$gene)) {\n", + " sub_df <- df[df$gene == g, ]\n", + " mean_treatment = robust_mean(sub_df[sub_df$condition == \"treatment\", \"expression\"])\n", + " mean_control = robust_mean(sub_df[sub_df$condition == \"control\", \"expression\"])\n", + " print(paste(g, \", treatment:\", mean_treatment, \", control:\", mean_control))\n", + "}\n" + ] + } + ], + "metadata": { + "celltoolbar": "Slideshow", + "kernelspec": { + "display_name": "R", + "language": "R", + "name": "ir" + }, + "language_info": { + "codemirror_mode": "r", + "file_extension": ".r", + "mimetype": "text/x-r-source", + "name": "R", + "pygments_lexer": "r", + "version": "4.5.3" + } + }, + "nbformat": 4, + "nbformat_minor": 5 +}