Published 293 files

Author: quartz-syncer-publisher[bot]

content/2-genbank_ref.png

@@ -14,7 +14,7 @@ used, for example 25 µL 2x PCR mastermix for a 50 µL PCR reaction. Scale up or
 
 See [[standard pcr protocol]].
 
-###  1.5x Green PCR mastermix (mastermix with PCR compatible loading buffer)
+### 1.5x Green PCR mastermix (mastermix with PCR compatible loading buffer)
 
 The 2xPCR mastermix can be combined with a PCR compatible loading buffer such as the in described in the table below. This saves time if you have many samples as they can be loaded directly on a gel. Use 33 µL of the 1.5x Green PCR mastermix for a 50 µL PCR reaction. Scale up or down as needed.
 
@@ -23,15 +23,12 @@ The 2xPCR mastermix can be combined with a PCR compatible loading buffer such as
 | 2x PCR mastermix                                                | 25  |
 | [[6x DNA loading buffer\|6 x DNA loading buffer (PCR compatible)]] | 8   |
 | Total                                                           | 33  |
+
 ### For MEC lab members:
 
 This [google sheet](https://docs.google.com/spreadsheets/d/1KWIgyq6alo-SgLN6TYQieGoHQNPxkIb1-JcRGnsbUoc/edit#gid=849990250) contains the recipe above. Create a new tab named after the date of preparation in [ISO 8601](https://xkcd.com/1179) format.
 Copy paste an old recipe and modify if necessary.
 
-
-
-
-
 ### Testing
 
 Since we make our own mastermix, we need a standardized test. We use the following mix:
@@ -41,7 +38,7 @@ Since we make our own mastermix, we need a standardized test. We use the followi
 - 10 µL Primer 18
 - 2 µL Chromosomal DNA from yeas
 
-The primers amplify a 1288 bp PCR product from the DFR1 locus in *S. cerevisiae*
+The primers amplify a 1288 bp PCR product from the DFR1 locus in _S. cerevisiae_
 using this program consisting of initial denaturation for 4 min at 94 °C, followed by 30 cycles of 94 °C for 30s, 50 °C for 30s, and 72 °C for 45 s, and a final extension at 72 °C for 5 min. [Source](https://link.springer.com/book/10.1007/978-1-0716-3358-8)
 
 ```
@@ -56,5 +53,6 @@ using this program consisting of initial denaturation for 4 min at 94 °C, follo
 This PCR reaction is very robust and gives a high yield.
 
 Primers
-- 19_D-DFR1 GACTCAGACAGGTTGAAAAGAAGAC
-- 18_A-DFR1 CAAAGGTTTGGTTTTCAGTTAAGAA
+
+- 19\_D-DFR1 GACTCAGACAGGTTGAAAAGAAGAC
+- 18\_A-DFR1 CAAAGGTTTGGTTTTCAGTTAAGAA

content/2x PCR mastermix.md

@@ -10,9 +10,10 @@ with two volumes of water (for example 20 µL ). Mix well and put 4 µL drops of
 This mixture will have the right fraction of loading buffer.
 
 ## Preparation
+
 The table below contain the components of a 6x loading buffer used in the lab. It has two colors
 one bluish that migrates slowly and one yellow that migrates rapidly. This loading buffer should be
-compatible with PCR (see below). Note that the buffer should contain either Orange G *or* Tartrazine
+compatible with PCR (see below). Note that the buffer should contain either Orange G _or_ Tartrazine
 as the yellow color. Orange G is preferred since it migrates faster.
 
 | Component                     |Quantity |Concentration (w/v)| Final concentration       |Function       |
@@ -24,38 +25,35 @@ as the yellow color. Orange G is preferred since it migrates faster.
 | Water                         | -       | to 50 mL          |                           | -             |
 | Total                         | 50 mL   |                   |                           |               |
 
-	
 Recipe for 50 mL 6x DNA loading buffer:
 
 - add 6.25g [FICOLL 400](https://www.sigmaaldrich.com/catalog/product/sigma/f2637) powder to a new 50 mL FALCON tube.
 - add [[ddH2O]] to about 30 mL, shake to dissolve. This may take time, heating the tube in a water bath helps.
 - add 7.5 mg Xylene Cyanol FF powder
-- add 7.2 mL Orange G (1% w/v) ***OR*** 900 µL of VAHINE yellow contains [Tartrazine](http://en.wikipedia.org/wiki/Tartrazine)
+- add 7.2 mL Orange G (1% w/v) _**OR**_ 900 µL of VAHINE yellow contains [Tartrazine](http://en.wikipedia.org/wiki/Tartrazine)
 - add water to 50 mL
 
 The resulting solution is about the same colour as the GoTaq green flexi buffer commercialized
 by [Promega](https://worldwide.promega.com/products/pcr/endpoint-pcr/gotaq-reaction-buffers/?catNum=M7911).
 The gel below shows GoTaq green flexi buffer loaded on gel.
 
-
 ![[gotaq.jpg]]
 
-
 This loading buffer is be compatible with PCR, add it to 16% (v/v) of the final PCR (8 µL in a 50 µL reaction) volume. This can be added to the [[2x PCR mastermix]].
 
-
 The yellow food coloring contain Tartrazine (E102). In this case, exact concentration
 is not known, but could be measured using a spectrophotometer at the absorption
 maximum of 472 nm. The molar absorptivity of Tartrazine at 472 nm is 20,330 L mol-1 cm-1.
 
-
 ### Developmen
 
 #### FICOLL 400 (Density)
 
 From invitrogens website I found the following information:
 
-    Xylene Cyanol (0.02%), Tartrazine and Ficoll (2.5%) do not inhibit this enzyme (recombinant Taq).
+```
+Xylene Cyanol (0.02%), Tartrazine and Ficoll (2.5%) do not inhibit this enzyme (recombinant Taq).
+```
 
 The information was avaliable thorugh this [link](http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/PCR/pcr-enzymes-master-mixes/taq-dna-polymerase-enzymes/taq_dna_polymerase.html).
 
@@ -65,9 +63,11 @@ This suggests that 2.5% ficoll could be added to a PCR reaction.
 
 Kramer 2001 suggests to add 0.5 - 1% Ficoll 400. Surpisingly they refer to v/v:
 
-    add Ficoll 400 to a final concentration of 0.5% to 1% (v/v)
+```
+add Ficoll 400 to a final concentration of 0.5% to 1% (v/v)
+```
 
-Kramer, M. F., & Coen, D. M. (2001). Enzymatic amplification of DNA by PCR: standard procedures and optimization. Current Protocols in Molecular Biology / Edited by Frederick M. Ausubel... [et Al.], Chapter 15, Unit 15.1.
+Kramer, M. F., & Coen, D. M. (2001). Enzymatic amplification of DNA by PCR: standard procedures and optimization. Current Protocols in Molecular Biology / Edited by Frederick M. Ausubel... \[et Al.], Chapter 15, Unit 15.1.
 
 #### Xylene Cyanol FF (Blue)
 
@@ -78,8 +78,8 @@ yields 0.0025% XyleneCyanol FF in the final 1x PCR mixture:
 [![[1X_Quick-Load_Taq_Master_Mix.png]]](M0271Datasheet-Lot0211206.pdf)
 
 The final loading buffer should have 0.0025% (w/v) dye.
-The loading buffer is 6x concentrated, so the loading buffer should have 0.0025 * 6 = 0.015% (w/v).
-If we assume a density of 1 g/mL (the final buffer is denser), we should add (0.015/100) * 50000 = 7.5 mg of dye to 50 mL.
+The loading buffer is 6x concentrated, so the loading buffer should have 0.0025 \* 6 = 0.015% (w/v).
+If we assume a density of 1 g/mL (the final buffer is denser), we should add (0.015/100) \* 50000 = 7.5 mg of dye to 50 mL.
 
 #### Orange G
 
@@ -101,7 +101,6 @@ The [[mccormick-food-coloring.jpg|McCormick food coloring]] seem equivalent to t
 VAHINE available in Portugal (see above). In our
 recipe the final concentration is (0.9 mL / 50 mL ) / 6 = 0.3 % (v/v).
 
-
 ### Misc
 
 VAHINE food coloring comes in a package with blue, red and yellow. It has the following components:
@@ -114,7 +113,6 @@ VAHINE food coloring comes in a package with blue, red and yellow. It has the fo
 
 ### Links
 
-
 - <http://www.wendychao.com/science/protocols/loading_buffer/>
 - <http://www.protocol-online.org/biology-forums-2/posts/12397.html>
 - <http://www.geneticorigins.org/pv92/recipes2.htm>

content/3-genbank_ref.png

@@ -1,5 +1,4 @@
-Example acknoledgement section updated on 2022-02-16:
-
+Example # Acknowledgement section updated on 2022-02-16:
 
 We thank Professors Jin Hou, Xiaoming Bao and colleagues for sending us the malonyl-CoA sensor.
 

content/4-genbank_ref.png

@@ -6,10 +6,11 @@ For this reason, you can prepare a sterile >twice concentrated agar solution
 in a Schott flask. These can be kept at room temperature almost indefinitely.
 
 For 500 mL solid medium (~20 plates):
+
 - 1 L Schott flask
 - 10 g Agar
-- ~200 mL water
+- \~200 mL water
 - Optional a magnetic stirrer bar
-Sterilize by autoclaving.
+  Sterilize by autoclaving.
 
 Add water and media components to 500 mL and heat in a microwave oven (5-10 min) until the agar has been dissolved.

content/6x DNA loading buffer.md

@@ -6,7 +6,6 @@ created: 2026-03-13T08:01:11.777+00:00
 modified: 2026-03-13T08:02:06.968+00:00
 ---
 
-
 ## Purpose
 
 Agarose gel electrophoresis separates DNA fragments based on size. It is commonly used to verify:
@@ -17,6 +16,7 @@ Agarose gel electrophoresis separates DNA fragments based on size. It is commonl
 - DNA fragment sizes
 
 DNA migrates through agarose toward the positive electrode because DNA is negatively charged. Smaller fragments move faster than larger ones.
+
 # Preparing DNA Samples for Loading
 
 DNA samples should be mixed with a **loading buffer** before loading into the gel in most cases.
@@ -44,11 +44,11 @@ You can add loading buffer to PCR by substituting some of the water added. For e
 PCR reaction mix, substitute 17 µL of water with [[6x DNA loading buffer]].
 
 You can also prepare [[2x PCR mastermix]] with loading buffer. For each 100 µL of 2x mastermix, substitute
-17 * 2 = 34 µL of water with [[6x DNA loading buffer]].
+17 \* 2 = 34 µL of water with [[6x DNA loading buffer]].
 
 > [!WARNING]
->Not all loading buffers are PCR compatible. Do not use other loading buffers in the lab without verifying tha
->the buffer is compatible with PCR
+> Not all loading buffers are PCR compatible. Do not use other loading buffers in the lab without verifying tha
+> the buffer is compatible with PCR
 
 # Using 6× Loading Buffer
 
@@ -72,7 +72,6 @@ For example, if you digested 2 µL plasmid DNA in a total of 10 µL and you want
 If you have several, samples, spot the loading buffer on a piece of parafilm as shown below. Add water if needed
 and then the DNA just before loading the gel. This saves a lot of time and plastic tubes.
 
-
 ![[GEL-1.png]]
 
 # Typical Agarose Gel Percentages
@@ -86,16 +85,12 @@ and then the DNA just before loading the gel. This saves a lot of time and plast
 
 Higher agarose concentrations resolve smaller fragments better.
 
-
 <http://www.gelanalyzer.com/index.html>
 <http://sourceforge.net/projects/pyelph/files/releases/>
 
-
-
-
 - [[How many times can I reuse electrophoresis buffer?]]
 - [[TAE]]
-- [[FatVal]]
+- [[fatval]]
 - [[Turner]]
 - [[Bachman]]
 - [[Midori Green DNA loading buffer (LBx2wMidori)]]