Published multiple files

Author: Quartz Syncer

content/Chocolate Mousse.md

@@ -1,11 +1,11 @@
 ![[Chocolate Mousse.jpg|646|646x817]]
 
 INGREDIENTS
-• 200 grams dark chocolate
-• 6 eggs (separated)
-• 6 tablespoons sugar (level tablespoons)
-• 1 tablespoons butter (level tablespoon)
-• 1 pinch pinch of salt
+- 200 grams dark chocolate
+- 6 eggs (separated)
+- 6 tablespoons sugar (level tablespoons)
+- 1 tablespoons butter (level tablespoon)
+- 1 pinch pinch of salt
 
 STEPS
 1. Melt the chocolate: Melt 200 grams dark chocolate in a bain-marie (double boiler) together with 1 tablespoons butter (level tablespoon).

content/The Yeast Pathway Kit.md

@@ -140,7 +140,7 @@ Some alternative primers:
             >-TP-->           \     /           >-TP-->
              \   /             \   /             \   /
      517>     \ /               \ /               \ /
- p577>    1123>|p468>       <p567|p568>       <p467|<494        <p578    
+ p577>    1123>|p468>       <p567|p568>       <p467|<494        <p578
                |                 |                 |
                |                 |                 |
                |                 |                 |
@@ -196,7 +196,7 @@ cttcacaggcggttttcgcacgtacccatgcgctacgttcctggccctcttcaaacaggcccagttcgccaataaaatca
 *promoter=
          =mcs~
              ~gfp+
-                 +CYC1t•    
+                 +CYC1t•
 ```
 
 ~ = [[linkers]] (35 bp)

content/XL1-blue.md

@@ -1,2 +1,3 @@
 XL1-Blue cells have mcr and mrr restriction systems, which can affect the cloning of certain DNA sequences.
+
 DH5-alpha lacks these systems.

content/in silico assembly of pYPKa_A_ATF1.md

@@ -39,7 +39,7 @@ dragging the sequence file to the empty ApE window. See the result below. The se
  ![[in silico assembly of pYPKa_A_ATF1-20240709173627486.png]]
 
 Find  The **[AjiI](http://rebase.neb.com/rebase/enz/AjiI.html)** has the same specificity as the enzymes(or ** [BtrI](http://rebase.neb.com/rebase/enz/BtrI.html) ** or **[BmgBI](http://rebase.neb.com/rebase/enz/BmgBI.html)**). Use the Enzymes>Enzyme selector option and try to find the AjiI restriction site.
-You can also use the Edit>Find or CTRL-F search to find the recognition sequence of the enzyme (CACGTC). 
+You can also use the Edit>Find or CTRL-F search to find the recognition sequence of the enzyme (CACGTC).
 
 If **AjiI** is not available in the enzyme selection of ApE, try to find  **BtrI** instead.
 
@@ -50,7 +50,7 @@ Paste the PCR product sequence at the cut site of the pYPKa. See figure below.
 > [!IMPORTANT]
 > Paste only the DNA sequence of the PCR product, do not include the FASTA header.
 
-## 3. Analyze result
+## 3. Analyze resul
 
 Calculate the **size** and complete **seguid checksum** of the resulting plasmid.
 

content/misc/recept/curry.md

@@ -1,5 +1,7 @@
 # Jaitinder's chickpea curry 
 
+![[misc/recept/curry.png|600x750]]
+
 - 3 onions, chopped    
 - 1 large paprika (bell pepper), chopped _(or 2 small)_    
 - 4 carrots, sliced    

content/misc/recept/curry.png

@@ -69,19 +69,21 @@ The nucleotides immediately upstream of the start codon ([Kozak consensus sequen
 ```
 >f1800
 tctgcaataATGggtTTGTGTTCAGTAATTCAGAGA
---K528---
-        sta
-           gly
+
+--K528---   gly
+         sta
+
 ```
-The primer above has the K528 Kozak sequence, a start codon and a glycine codon followed by the new primer sequence. The Pydnaweb [WebPCR](https://pydnaweb.streamlit.app/pcr) simulator confirms the annealing of the primers (below) and also provides a suitable PCR program for two kinds of DNA polymerases (not shown).
+The primer above has the K528 Kozak sequence, a start codon and a glycine codon followed by the new primer sequence.
+The Pydnaweb [WebPCR](https://pydnaweb.streamlit.app/pcr) simulator confirms the annealing of the primers (below) and also provides a suitable PCR program for two kinds of DNA polymerases (not shown).
 
 ```
 			   5TTGTGTTCAGTAATTCAGAGA...TGGAAAAGACTCTCATCTAA3
 									 ||||||||||||||||||||
 									3ACCTTTTCTGAGAGTAGATT5
 5tctgcaataATGggtTTGTGTTCAGTAATTCAGAGA3
-               |||||||||||||||||||||
-			  3AACACAAGTCATTAAGTCTCT...ACCTTTTCTGAGAGTAGATT5
+                |||||||||||||||||||||
+		       3AACACAAGTCATTAAGTCTCT...ACCTTTTCTGAGAGTAGATT5
 ```
 
 
@@ -92,7 +94,7 @@ The primer above has the K528 Kozak sequence, a start codon and a glycine codon
 Genes can be cloned by gap repair in the Yeast Pathway Kit system instead of cloning into pYPKa. The primer tails below provide the PCR product with flanking homology to the promoter and terminator.
 
 ```
-  
+
 <-- Forward tail 28 nt ---->
 actttctcactagtgacctgcagccGAC-(Kozak)-ATG...
                                      ---
@@ -102,16 +104,16 @@ actttctcactagtgacctgcagccGAC-(Kozak)-ATG...
 ctgatgcgtttgtctgcacagatggCAC...???
                             ---
                             stp
-                            
+
 ```
 
 In our case the final primers will be (### = start, stop codons):
 
 ```
-actttctcactagtgacctgcagccGAC-tctgcaataATGggtTTG........
---------- tail-------------- ..kozak..###lys
-                                    
+actttctcactagtgacctgcagccGAC-tctgcaata-ATGggtTTG........
+--------- tail-------------- kozakk... ###lys
+
 ctgatgcgtttgtctgcacagatggCAC-TTAGATGAGAGTCTTTTCCA.......
---------- tail-------------- ###                            
+--------- tail-------------- ###
 ```