Met thread panicked issue during running

[guoxinyicindy]

Hi!

I've encountered thread panicked issue during running procedures.

The error message is as below:

thread '<unnamed>' (323853) panicked at src/genotype.rs:657:101:
Unable to align read with seq [] to repeat-compressed reference for chr21:6558962-6558988
Sequence is empty

thread '<unnamed>' (323853) panicked at src/genotype.rs:657:101:
Unable to align read with seq [] to repeat-compressed reference for chr21:6814622-6815165
Sequence is empty

The input is a BAM file and the BED file looks like this:

chr21	6087215	6087285	ACACAGGCAGCCTCCCCACCTGGGACCCC	chr21-6087215-6087285
chr21	6116606	6116775	AAGCTGGCAGGCACGGAGGGTCCGGGGTGGGAGCAGGGACATC	chr21-6116606-6116775
chr21	6145495	6145618	ACACACCGTCACCTGCCTGGGCCGTGCTGTCT	chr21-6145495-6145618
chr21	6149429	6149544	AAACCGCCTGTTCTCTAAACGTATATCCGTGTATGT	chr21-6149429-6149544
chr21	6254020	6254032	AAT	chr21-6254020-6254032
chr21	6302640	6302675	AAAAAGAG	chr21-6302640-6302675
chr21	6324155	6324183	AGCCCAGCCCCCC	chr21-6324155-6324183
chr21	6364989	6365058	AAAATTGTATAAATTAAACTTAC	chr21-6364989-6365058

May I know why this happened?

[wdecoster]

Hi @guoxinyicindy,

Thanks for reporting this! Could you let me know how the BAM file was generated?

Wouter

[zhengzhenxian]

Hi Wouter,

Thank you for looking in this! We are using the GIAB HG001 WGS BAM acquried from ONT EPI2ME Labs(https://epi2me.nanoporetech.com/giab-2025.01/). For your reference, I have provided access to both the full WGS BAM and a subset file containing only chromosome 20 alignments (https://www.bio8.cs.hku.hk/str/data/). Let us know if need more, thanks!

Zhenxian

[wdecoster]

In my latest version, I was unable to reproduce your error with the subsetted BAM files, but I added a fix that should prevent it anyway. I will have v0.18.0 available soon. Could you test and let me know?