Skip to content

Repository files navigation

fastahack --- *fast* FASTA file indexing, subsequence and sequence extraction

Author: Erik Garrison <erik.garrison@bc.edu>, Marth Lab, Boston College
Date:   May 7, 2010


Overview:

fastahack is a small application for indexing and extracting sequences and
subsequences from FASTA files.  The included Fasta.cpp library provides a FASTA
reader and indexer that can be embedded into applications which would benefit
from directly reading subsequences from FASTA files.  The library automatically
handles index file generation and use.


Features:

 - FASTA index (.fai) generation for FASTA files
 - Sequence extraction
 - Subsequence extraction
 - Sequence statistics (TODO: currently only entropy is provided)

Sequence and subsequence extraction use fseek64 to provide fastest-possible
extraction without RAM-intensive file loading operations.  This makes fastahack
a useful tool for bioinformaticists who need to quickly extract many
subsequences from a reference FASTA sequence.


Notes:

The index files generated by this system should be numerically equivalent to
those generated by samtools (http://samtools.sourceforge.net/).  However, while
samtools truncates sequence names in the index file, fastahack provides them
completely.

To simplify use, sequences can be addressed by first whitespace-separated
field; e.g. "8 SN(Homo sapiens) GA(HG18) URI(NC_000008.9)" can be addressed
simply as "8", provided "8" is a unique first-field name in the FASTA file.
Thus, to extract 20bp starting at position 323202 in chromosome 8 from the
human reference:

  % fastahack -r 8:323202..20 h.sapiens.fasta
  ACATTGTAATAGATCTCAGA

Usage information is provided by running fastahack with no arguments:

  % usage: fastahack [options] <fasta reference>
  
  options:
      -i, --index          generate fasta index <fasta reference>.fai
      -r, --region REGION  print the specified region
      -c, --stdin          read a stream of line-delimited region specifiers on stdin
                           and print the corresponding sequence for each on stdout
      -e, --entropy        print the shannon entropy of the specified region
  
  REGION is of the form <seq>, <seq>:<start>..<end>, <seq1>:<start>..<seq2>:<end>
  where start and end are 1-based, and the region includes the end position.
  Specifying a sequence name alone will return the entire sequence, specifying
  range will return that range, and specifying a single coordinate pair, e.g.
  <seq>:<start> will return just that base.


Limitations:

fastahack will only generate indexes for FASTA files in which the sequences
have self-consistent line lengths.  Trailing whitespace is allowed at the end
of sequences, but not embedded within the sequence.  These limitations are
necessitated by the complexity of indexing sequences whose lines change in
length--- the use of indexes is frustrated by such inconsistencies; each change
in line length would require a new entry in the index file.

About

utilities for indexing and sequence extraction from FASTA files

Resources

Stars

59 stars

Watchers

3 watching

Forks

Releases

Packages

Contributors

Languages